Informasi

Apa perbedaan antara DPY-10, DPY-11, dan DPY-13?

Apa perbedaan antara DPY-10, DPY-11, dan DPY-13?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

TA saya menyebutkan tiga mutasi C. elegans ini sejak kami mulai bekerja dengan worm tetapi tampaknya mengabaikan apa perbedaannya…


Dpy adalah kelas gen. Biasanya mereka ditulis dalam huruf kecil ketika mengacu pada alel mutan. Nama Dpy sendiri merupakan singkatan dari dumpy dan berasal dari perubahan morfologi yang terjadi ketika satu atau lebih gen bermutasi: cacing tampak pendek dan gemuk, atau dumpy.

Kelas besar lainnya adalah Unc. Mutasi pada gen tersebut menyebabkan gerakan yang tidak terkoordinasi.

Untuk deskripsi gen, lihat http://www.wormbase.org


Prolyl 4-hydroxylase diperlukan untuk viabilitas dan morfogenesis dalam Caenorhabditis elegans

genom dari Caenorhabditis elegans memiliki dua gen, dpy-18 dan phy-2, yang mengkode subunit dari enzim prolil 4-hidroksilase. Kami telah menghasilkan penghapusan dalam setiap gen untuk menghilangkan aktivitas prolyl 4-hidroksilase dari hewan. NS dpy-18 mutan memiliki morfologi tubuh yang menyimpang, sesuai dengan peran prolyl 4-hydroxylase dalam pembentukan kutikula tubuh. NS phy-2 mutan adalah tipe fenotip liar. Namun, dpy-18 phy-2 mutan ganda tidak layak, menunjukkan peran penting untuk prolyl 4-hydroxylase yang biasanya dicapai dengan baik dpy-18 atau phy-2. Efek dari mutasi ganda ditiru oleh inhibitor molekul kecil dari prolyl 4-hydroxylase, memvalidasi hasil genetik dan menunjukkan bahwa C. elegan dapat berfungsi sebagai sistem model untuk penemuan inhibitor baru.

Kolagen adalah protein yang paling melimpah pada hewan. Setiap rantai polipeptida kolagen terdiri dari pengulangan urutan: X-Y-Gly, di mana X sering merupakan residu l-prolin, dan Y sering merupakan 4(R)-hidroksi-l-prolin (Hyp) residu. Rantai ini dililit menjadi tiga heliks yang rapat, yang disusun menjadi fibril dengan kekuatan tarik yang besar. Gugus hidroksil dari residu Hyp berkontribusi besar terhadap stabilitas konformasi kolagen triple-heliks (1–3). Residu hyp tidak dimasukkan ke dalam kolagen oleh ribosom. Sebaliknya, hidroksilasi residu Pro dalam untaian kolagen dikatalisis oleh enzim prolyl 4-hydroxylase (EC 1.14.11.2). Prolyl 4-hydroxylase paling baik dicirikan pada vertebrata, termasuk manusia (4-7). Enzim vertebrata adalah tetramer, terdiri dari dua subunit dan dua subunit . Subunit mengikat kation divalen Fe2+, -ketoglutarat dan askorbat, dan memiliki situs aktif untuk hidroksilasi. Subunit tidak hanya merupakan komponen esensial dari tetramerik prolil 4-hidroksilase, tetapi juga memiliki aktivitas enzimatiknya sendiri sebagai protein disulfida isomerase (EC 5.3.4.1), suatu enzim yang mengkatalisis penguraian ikatan disulfida non-asli (8-10 ). Kekurangan aktivitas prolyl 4-hydroxylase diamati pada hewan yang kekurangan vitamin C makanan dan memiliki konsekuensi yang parah, mengakibatkan kondisi penyakit yang dikenal sebagai penyakit kudis (11).

Kami telah mulai menyelidiki peran biologis prolyl 4-hydroxylase dalam Caenorhabditis elegans. Nematoda kecil ini memberikan beberapa keuntungan eksperimental penting untuk in vivo studi: genetika maju dan mundur yang canggih (12, 13), morfologi tubuh sederhana yang dapat dianalisis pada tingkat sel individu (14), dan urutan genom yang hampir lengkap (15). Kolagen adalah komponen utama dari C. elegan, terdiri dari sekitar 1% dari berat nematoda dewasa (16). Paling C. elegan kolagen ada di kutikula dan membran basal (17).

Satu subunit prolyl 4-hidroksilase dan dua subunit potensial diidentifikasi dalam C. elegan genom dan dikarakterisasi secara biokimia (18, 19). NS C. elegan Subunit dan keduanya homolog dengan rekan vertebrata mereka. Namun, berbeda dengan enzim vertebrata tetramerik, C. elegan subunit membentuk dimer dengan salah satu dari C. elegan subunit atau subunit manusia (protein disulfida isomerase). Seperti vertebrata prolyl 4-hydroxylase, C. elegan enzim berinteraksi dengan kation divalen Fe 2+, -ketoglutarat dan askorbat, kofaktor prolil 4-hidroksilase, dan juga memiliki aktivitas prolil 4-hidroksilase (18, 19).

Di sini, kami melaporkan bahwa C. elegan genom memiliki dua gen yang mengkodekan subunit dari prolyl 4-hidroksilase. Kami telah menghasilkan mutan penghapusan setiap gen dan mengeksplorasi peran biologis mereka. Satu gen, dpy-18, sangat penting untuk morfologi tubuh tipe liar yang lain, phy-2, diperlukan untuk dpy-18 kelangsungan hidup mutan, dan sebaliknya. Kami juga telah menunjukkan bahwa penghambat molekul kecil prolyl 4-hydroxylase yang diketahui dapat meniru hilangnya dpy-18 dan phy-2 aktivitas gen.


Abstrak

Fenotip perilaku organisme model banyak digunakan untuk menyelidiki aspek fundamental biologi organisme, mulai dari fungsi sistem saraf hingga efek mutasi genetik, serta untuk menyaring senyawa obat baru. Namun, kapasitas kami untuk mengamati dan mengukur rentang penuh dan kompleksitas respons perilaku dibatasi oleh ketidakmampuan teknik mikroskopi konvensional untuk menangkap informasi gambar volumetrik dengan kecepatan yang memadai. Dalam artikel ini kami menjelaskan bagaimana menggabungkan mikroskop medan cahaya dengan estimasi kedalaman komputasi menyediakan metode baru untuk penilaian kuantitatif cepat dari postur 3D dan pergerakan model organisme Caenorhabditis elegans (C. elegan). Kami menerapkan teknik ini untuk membandingkan perilaku mutan kolagen kutikula, menemukan perbedaan signifikan dalam postur dan penggerak 3D. Kami mendemonstrasikan kemampuan mikroskop medan cahaya kuantitatif untuk memberikan wawasan fundamental baru tentang C. elegan penggerak dengan menganalisis mode postural 3D dari cacing yang berenang bebas. Akhirnya, kami mempertimbangkan manfaat relatif dari metode ini dan aplikasinya yang lebih luas untuk pencitraan fenotipik organisme lain dan untuk aplikasi bioimaging volumetrik lainnya.

Kutipan: Shaw M, Zhan H, Elmi M, Pawar V, Essmann C, Srinivasan MA (2018) Fenotip perilaku tiga dimensi bergerak bebas C. elegan menggunakan mikroskop medan cahaya kuantitatif. PLoS ONE 13(7): e0200108. https://doi.org/10.1371/journal.pone.0200108

Editor: Giorgio F. Gilestro, Imperial College London, INGGRIS

Diterima: 17 Januari 2018 Diterima: 19 Juni 2018 Diterbitkan: 11 Juli 2018

Hak cipta: © 2018 Shaw dkk. Ini adalah artikel akses terbuka yang didistribusikan di bawah ketentuan Lisensi Atribusi Creative Commons, yang mengizinkan penggunaan, distribusi, dan reproduksi tanpa batas dalam media apa pun, asalkan penulis dan sumber aslinya dicantumkan.

Ketersediaan Data: Data yang mendasari penelitian ini telah diunggah ke figshare dan dapat diakses menggunakan DOI berikut: 10.6084/m9.figshare.6670805.

Pendanaan: Pekerjaan ini didanai oleh Hibah Lanjutan 247401 kepada MAS dari European Research Council (ERC-2009-AdG, MicroNanoTeleHaptics), dan hibah Modal untuk hibah Great Technologies (EP/K005030/1 kepada MAS) dari Teknik dan Ilmu Fisika Inggris Dewan Riset. Para penyandang dana tidak memiliki peran dalam desain studi, pengumpulan dan analisis data, keputusan untuk menerbitkan, atau persiapan naskah.

Kepentingan bersaing: Para penulis telah menyatakan bahwa tidak ada kepentingan yang bersaing.


BAHAN DAN METODE

Semua C. elegan galur mutan berasal dari galur N2 Bristol tipe liar dan mengandung satu atau lebih alel berikut: rol-6(su1006) II, lin-8(n111) II, lin-9(n112) III, spe-48(hc85) I (sebelumnya diidentifikasi sebagai spesifikasi-8), spesifikasi-10(hc104) V, dpy-11(e224) V, unc-76(e911) V. Strain Hawaii isolat CB4856 (Hodgkin & amp Doniach, 1997) digunakan untuk pemetaan polimorfisme. Pengeditan gen yang dimediasi CRISPR untuk membuat sp-48 (gd11) dilakukan seperti yang dijelaskan sebelumnya (Paix dkk., 2015), menggunakan dpy-10 sebagai penanda co-CRISPR (Arribere dkk., 2014). Reagen CRISPR tercantum dalam Tabel Tambahan S1. Cacing diperbanyak menggunakan kondisi pertumbuhan standar (Brenner, 1974). Tes kesuburan dilakukan seperti yang dijelaskan sebelumnya (Kulkarni dkk., 2012).

Pustaka pengurutan dibuat menggunakan kit persiapan sampel DNA TruSeq v2 untuk sampel input besar atau kit persiapan sampel TruSeq ChIP untuk sampel input rendah (Illumina, San Diego, CA). Secara singkat, sampel gDNA dicukur dengan sonikasi, diperbaiki akhir, ekor A, ligasi adaptor, dan diperkuat PCR. Protokol terperinci untuk mendapatkan gDNA yang dicukur dari sampel input rendah dapat ditemukan di Suplemen (File S1). Perpustakaan diurutkan pada HiSeq 2500 (Illumina, San Diego, CA) untuk menghasilkan pembacaan 50bp, dan menghasilkan cakupan genom >20 kali lipat per sampel. Versi genom WS220 (www.wormbase.org) digunakan sebagai referensi. Data SNP pada Gambar 1 ditentukan dengan pipa BFAST (Homer dkk., 2009) untuk penyelarasan dan SAMtools (Li dkk., 2009) untuk panggilan varian. Semua data SNP lainnya diperoleh menggunakan BBMap (Bushnell, 2015) untuk penyelarasan dan FreeBayes (Garrison dan Marth, 2012) untuk panggilan varian. Bacaan duplikat dihapus setelah penyelarasan dan, kecuali dinyatakan lain, setidaknya tiga pembacaan independen diperlukan untuk panggilan varian. ANNOVAR (Wang dkk., 2010) digunakan untuk anotasi. Untuk pemetaan polimorfisme, frekuensi SNP dengan regresi LOESS diplot terhadap posisi kromosom dengan R (R Core Team, 2015) menggunakan parameter yang sama yang dilaporkan untuk CloudMap (Minevich dkk., 2012). Data urutan tersedia di NCBI Sequence Read Archive (nomor akses BioProject PRJNA305991).


Penerapan Pengeditan Genom CRISPR-Cas9 di Caenorhabditis elegans

Rekomendasikan Dokumen

Naskah yang Diterima Penerapan pengeditan genom CRISPR-Cas9 di Caenorhabditis elegans Suhong Xu PII:

Jurnal Genetika dan Genomik

Tanggal Diterima: 11 Mei 2015 Tanggal Revisi:

Tanggal Diterima: 19 Juni 2015

Silakan kutip artikel ini sebagai: Xu, S., The application of CRISPR-Cas9 genome editing in Caenorhabditis elegans, Journal of Genetics and Genomics (2015), doi: 10.1016/j.jgg.2015.06.005. Ini adalah file PDF dari naskah yang belum diedit yang telah diterima untuk diterbitkan. Sebagai layanan kepada pelanggan kami, kami menyediakan versi awal naskah ini. Naskah akan menjalani copyediting, typesetting, dan review dari bukti yang dihasilkan sebelum diterbitkan dalam bentuk akhirnya. Harap dicatat bahwa selama proses produksi dapat ditemukan kesalahan yang dapat mempengaruhi konten, dan semua penolakan hukum yang berlaku untuk jurnal terkait.

Penerapan pengeditan genom CRISPR-Cas9 di Caenorhabditis elegans

Divisi Ilmu Biologi, Bagian Sel dan Biologi Perkembangan, University of California,

San Diego, 9500 Gilman Drive, La Jolla, CA 92093

Korespondensi harus ditujukan ke: [email protected]

Pengeditan genom menggunakan endonuklease Cas9 dari Streptococcus pyogenes telah menunjukkan hal yang tak tertandingi

khasiat dan fasilitas untuk memodifikasi genom dalam berbagai organisme. Caenorhabditis elegans adalah

salah satu organisme multiseluler paling nyaman untuk analisis genetik, dan penerapan novel ini

teknik pengeditan genom untuk organisme ini menjanjikan untuk merevolusi analisis fungsi gen di

masa depan. CRISPR-Cas9 telah berhasil digunakan untuk menghasilkan penyisipan dan penghapusan yang tidak tepat melalui non-

mekanisme penyambungan akhir yang homolog dan untuk membuat mutasi yang tepat dengan perbaikan yang diarahkan oleh homologi dari

template donor. Variabel kunci adalah metode pengiriman endonuklease Cas9 dan

efisiensi RNA panduan tunggal. Pengeditan yang dimediasi CRISPR-Cas9 tampaknya sangat spesifik dalam C.

elegans, tanpa efek di luar target yang dilaporkan. Ulasan ini secara singkat merangkum kemajuan terbaru dalam CRISPR-

Pengeditan genom berbasis Cas9 di C. elegans, menyoroti peningkatan teknis dalam mutagenesis dan

deteksi mutasi, dan mendiskusikan aplikasi potensial masa depan dari teknik ini.

Kata kunci: pengeditan genom, CRISPR, Cas9, non-homologous end-joining (NHEJ), diarahkan homologi

perbaikan (HDR), mutasi somatik, C. elegans

Terobosan terbaru dalam teknologi pengeditan genom yang memungkinkan modifikasi yang tepat dari

DNA terdampar dari suatu organisme menjanjikan untuk membuka peluang yang belum pernah terjadi sebelumnya untuk identifikasi dan

karakterisasi fungsi gen dalam proses biologis. Teknologi berharga ini bergantung pada temuan

bahwa sel eukariotik memiliki mekanisme endogen untuk memperbaiki DNA double-strand break (DSBs) (Carroll,

2011). DSB yang ditargetkan dapat diperbaiki baik melalui non-homologous end-joining (NHEJ) yang rawan kesalahan

jalur perbaikan, yang menginduksi mutasi penyisipan atau penghapusan kecil (indel) yang dapat menghasilkan bingkai

pergeseran di wilayah pengkodean, atau melalui jalur perbaikan yang diarahkan homologi (HDR), yang memperkenalkan spesifik

mutasi titik atau penyisipan/penghapusan urutan yang diinginkan dengan rekombinasi homolog dengan

template DNA yang disediakan secara eksogen. Metode pengeditan genom terbaru juga menggunakan nuklease yang dapat diprogram

untuk memperkenalkan gangguan gen, penyisipan, atau substitusi urutan genom secara terkendali

(Segal dan Meckler, 2013 Maggio dan Goncalves, 2015). Beberapa endonuklease yang disesuaikan telah

digunakan dalam pengeditan genom dalam dekade terakhir, seperti meganucleases, zinc-finger nucleases (ZFNs) dan

nuklease efektor seperti aktivator transkripsi (TALENs) (Hsu et al., 2014 Maggio dan Goncalves, 2015).

Mereka memungkinkan manipulasi genom spesifik melalui interaksi protein-DNA untuk penargetan. Semua

pendekatan ini telah memberikan informasi berharga tentang pengeditan genom, namun masing-masing memiliki keunikan

kelemahan yang membatasi penerapannya yang lebih luas.

Pendekatan terbaru dan berkembang pesat dalam pengeditan genom adalah CRISPR (berkelompok secara teratur)

pengulangan palindromik pendek interspasi)-terkait protein 9 endonuklease (selanjutnya disebut sebagai Cas9),

berasal dari sistem imun adaptif bakteri (Doudna dan Charpentier, 2014). CRISPR-Cas9

sistem dapat digunakan untuk menargetkan hampir semua lokus genom melalui RNA pemandu yang mengenali target

DNA melalui pasangan basa Watson-Crick. Sistem CRISPR-Cas9 tipe II dari Streptococcus pyogenes adalah

yang paling sederhana dan paling banyak digunakan, dan telah terbukti memperkenalkan DSB spesifik lokasi yang

kemudian diperbaiki oleh NHEJ atau HDR (Doudna dan Charpentier, 2014). Komponen inti dari

sistem CRISPR-Cas9 adalah Cas9 endonuklease yang mengandung dua domain nuklease katalitik (RuvC

dan HNH), dan chimera RNA panduan tunggal (sgRNA) yang menggabungkan fungsi RNA CRISPR

(crRNA) dan trans-activating crRNA (tracrRNA) (Jinek et al., 2012). Persyaratan urutan spesifik

untuk pengeditan kromosom bergantung pada urutan 20 nt pada ujung 5′ dari sgRNA, yang harus

diikuti oleh motif yang berdekatan protospacer (PAM) dari NGG dalam DNA untuk pembelahan yang efisien (Gbr. 4b).

1). Dengan demikian, pengeditan genom yang dimediasi CRISPR-Cas9 dapat diprogram dan dapat dengan mudah ditargetkan ke sebagian besar

lokasi genomik pilihan melalui desain sgRNA. Dibandingkan dengan protein-dipandu lainnya

rekan-rekan, ZFNs dan TALENs, alat pengeditan genom yang dipandu RNA ini menawarkan beberapa keuntungan berbeda,

seperti kesederhanaan, aksesibilitas, keterjangkauan, dan multiplexing (Cong et al., 2013 Hsu et al., 2014).

Sejak demonstrasi penting dari pengeditan genom CRISPR-Cas9 pada tahun 2012 (Jinek et al., 2012), ini

sistem telah merevolusi genomik fungsional di banyak organisme model (Bassett et al., 2013 Belhaj et

al., 2013 Chang dkk., 2013 Chen dkk., 2013b Cong dkk., 2013 DiCarlo dkk., 2013 Friedland dkk.,

2013 Gratz dkk., 2013 Hwang dkk., 2013 Li dkk., 2013 Mali dkk., 2013b Wang dkk., 2013b Wei dkk.

al., 2013 Yu et al., 2013 Bassett dan Liu, 2014 Ma et al., 2014).

Nematoda Caenorhabditis elegans adalah organisme model genetik yang banyak digunakan, di mana

pendekatan genetik terbalik telah dikembangkan dengan baik. Pengeditan genom berbasis CRISPR-Cas9 telah

berhasil diterapkan pada C. elegans dan telah ditinjau baru-baru ini (Frokjaer-Jensen, 2013 Waaijers dan

Boxem, 2014). Di sini, saya merangkum perkembangan pesat dan penyempurnaan terbaru dari CRISPR-Cas9

sistem sebagai platform untuk mendapatkan modifikasi genom kustom. Saya membahas peningkatan terbaru dalam

Metodologi CRISPR-Cas9 dan aplikasinya di C. elegans.

PENGEMBANGAN CRISPR-CAS9 DI C. ELEGANS

Meskipun mutasi penghapusan yang diinduksi secara acak mudah dibuat dan dideteksi oleh PCR berbasis

penyaringan (Gengyo-Ando dan Mitani, 2000 Edgley et al., 2002 Barstead dan Moerman, 2006), C.

elegans telah lama tidak memiliki sistem genetik terbalik berbasis homologi yang efisien. Pendekatan awal mengandalkan

penggunaan penyisipan transposon (transposon Tc endogen atau Mos eksogen1) untuk membuat spesifik lokasi

DSB (Plasterk dan Groenen, 1992 Robert dan Bessereau, 2007 Frokjaer-Jensen et al., 2008 Frokjaer-

Jensen dkk., 2010 Frokjaer-Jensen dkk., 2012). Transposase dapat menghapus atau memasukkan yang diinginkan

urutan di situs penyisipan melalui HDR. Metode ini kuat dan memungkinkan pengeditan genom yang tepat,

tetapi dibatasi oleh kelangkaan relatif dari acara pengeditan dan kebutuhan akan situs penyisipan transposon

(Frokjaer-Jensen et al., 2008 Frokjaer-Jensen et al., 2010).

Baru-baru ini, pendekatan pengeditan genom berbasis nuklease (ZFNs dan TALENs) juga telah terbukti

bekerja di C. elegans (Wood et al., 2011 Cheng et al., 2013 Lo et al., 2013). Meskipun pendekatan seperti itu

mungkin berguna dalam situasi tertentu, cukup adil untuk mengatakan bahwa efisiensi dan kesederhanaan CRISPR-

Metode Cas9 telah mengambil alih komunitas C. elegans, menghasilkan ledakan penelitian tentangnya

aplikasi dan optimasi.

Untuk pengeditan genom yang dimediasi CRISPR-Cas9, persyaratan utama adalah ekspresi protein Cas9 dan

sgRNA dalam nukleus tempat kompleks Cas9-sgRNA-DNA akan dirakit. Ekspresi garis keturunan dari

Cas9 dan sgRNA diperlukan untuk menghasilkan perubahan yang dapat diwariskan, sementara ekspresi jaringan somatik dapat menghasilkan

mutasi somatik yang tidak diwariskan. Beberapa implementasi CRISPR-Cas9 telah dijelaskan di C.

elegans, masing-masing dengan kelebihan dan kekurangannya (Waaijers dan Boxem, 2014). Satu perbedaan penting

adalah bagaimana Cas9 dan sgRNA dikirim ke inti germline (Gbr. 1). Cas9 dapat dikirimkan melalui

mikroinjeksi mRNA yang ditranskripsi secara in vitro (Chiu et al., 2013 Katic dan Grosshans, 2013), protein murni

(Cho et al., 2013), atau DNA plasmid (Chen et al., 2013b Dickinson et al., 2013 Friedland et al., 2013 Lo

dkk., 2013 Tzur dkk., 2013). Demikian pula, sgRNA juga dapat diperkenalkan oleh transkripsi in vitro

(Chiu et al., 2013 Cho et al., 2013 Katic dan Grosshans, 2013) atau diekspresikan dalam germline menggunakan

Promotor RNA polimerase III seperti U6 (Chen et al., 2013b Dickinson et al., 2013 Friedland et al.,

2013 Tzur et al., 2013) (Tabel 1). Menariknya, makan bakteri, yang dapat memberikan gen spesifik ganda

RNA terdampar (dsRNA), juga dapat memasukkan RNA pemandu ke Cas9 yang mengekspresikan cacing untuk mencapai gen

gangguan (Liu et al., 2014). Studi-studi dasar ini membuka jalan bagi implementasi yang luas dari

Teknologi CRISPR-Cas9 sebagai alat pengeditan genom di C. elegans. Meskipun ada perbedaan dalam pengiriman, semua

dari pendekatan tersebut telah berhasil dalam menghasilkan mutasi. Karena kemudahan

kloning plasmid dibandingkan dengan pemurnian protein atau RNA, metode paling populer saat ini mengandalkan

mikroinjeksi plasmid yang mengekspresikan protein Cas9 dan sgRNA ke dalam germline, diikuti oleh

skrining keturunan berbasis fenotipe atau PCR.

Ekspresi protein Cas9 dan sgRNA yang berhasil dalam nukleus biasanya menghasilkan DSB ujung tumpul

pasangan basa hulu dari urutan PAM dalam kromosom. Cas9 memotong DNA menggunakan dua katalitik

domain: domain nuklease HNH yang memotong untai komplementer dengan sgRNA, dan RuvC

domain nuklease yang memotong untai non-komplementer (Gbr. 1). Kedua belahan dada telah terbukti

menginduksi gangguan genom NHEJ yang rawan kesalahan dan modifikasi genom tepat berbasis HDR di C. elegans.

Pengeditan genom yang tidak tepat melalui Penggabungan Akhir Non-Homolog

DSB DNA yang diinduksi nuklease Cas9 dapat diperbaiki melalui NHEJ, menghasilkan generasi yang efisien dari

penyisipan atau penghapusan kecil (indel), yang dapat mengganggu kerangka baca atau wilayah peraturan sehingga

menghasilkan mutasi kehilangan fungsi (Hsu et al., 2014) (Gbr. 1). Ekspresi germline dari Cas9 dan

sgRNA sangat penting untuk generasi mutasi yang diwariskan ini. Dalam C. elegans, mutasi indel dapat dengan mudah menjadi

diisolasi jika mereka mengarah ke fenotipe yang terlihat, seperti Unc (penggerak tidak terkoordinasi) atau Dpy (tubuh kosong

membentuk). Dalam percobaan awal, efisiensi pendekatan ini sangat bervariasi, mulai dari 0,5%―88%

tergantung pada sgRNA yang berbeda (Tabel 1). Karena inefisiensi deteksi mutasi oleh PCR, a

metode sgRNA ganda, yang menggunakan dua sgRNA yang menargetkan gen yang sama, dikembangkan untuk menghasilkan yang lebih besar

Penghapusan DNA yang berpotensi menghasilkan mutasi nol molekuler lengkap (Chen et al., 2014 Xu and

Chisholm, 2014). Memang, pendekatan sgRNA ganda telah dilaporkan menghapus hingga 24 kb antara

sgRNA (Chen et al., 2014).

Pengeditan genom yang tepat melalui Perbaikan yang Diarahkan Homologi

Dibandingkan dengan peristiwa NHEJ, yang menghasilkan spektrum mutasi di area target, yang dimediasi HDR

acara perbaikan menggunakan templat DNA yang berisi urutan homologi ke situs genom untuk menghasilkan target

modifikasi. Pengeditan genom yang bergantung pada HDR dapat digunakan untuk menginduksi mutasi titik yang tepat, tambah

tag penyisipan (misalnya GFP, FLAG) ke gen kromosom tertentu, atau menghapus seluruh gen dan menggantinya

dengan konstruksi ekspresi gen (misalnya GFP, kaset gen antibiotik) (Gbr. 1). Banyak laporan telah

telah ditunjukkan bahwa DSB yang diinduksi Cas9 dapat diperbaiki secara efisien oleh HDR di C. elegans (Chen et

al., 2013b Dickinson dkk., 2013 Lo dkk., 2013 Zhao dkk., 2014 Dickinson dkk., 2015).

Untuk HDR yang sukses, templat DNA donor juga diperlukan bersama dengan Cas9 dan sgRNA di

inti. Ada beberapa strategi untuk memasok template donor. Pendekatan pertama adalah dengan menggunakan plasmid

Template DNA, yang dapat digunakan untuk merekayasa berbagai macam perubahan DNA (Dickinson et al.,

2013). Namun, mengkloning lengan homologi yang diperlukan ke dalam vektor dapat memakan waktu. Alternatif yang menarik

adalah dengan menggunakan oligodeoksinukleotida untai tunggal (ssODNs), yang dapat disintesis secara komersial (Zhao et

al., 2014). Menariknya, fragmen DNA yang dihasilkan PCR telah berhasil digunakan sebagai templat donor

(Paix et al., 2014). Salah satu masalah potensial dari perbaikan yang dimediasi HDR adalah efisiensi yang rendah (Paix et al.,

2014 Zhao et al., 2014). Meskipun sulit untuk mendapatkan perkiraan yang tepat tentang efisiensi HDR, secara keseluruhan

dari karya-karya yang diterbitkan ini, mutan rekombinan diidentifikasi antara 0,4%―26,3% dari F1

hewan (Dickinson et al., 2013 Tzur et al., 2013 Paix et al., 2014 Zhao et al., 2014) (Tabel 1).

Menariknya, menonaktifkan aktivitas NHEJ dengan inaktivasi RNAi dari gen cku-80, yang mengkode C.

elegans protein pengikat DNA ujung tumpul (KU), dapat secara signifikan meningkatkan efisiensi HDR (Ward, 2015).

Namun demikian, metode yang disempurnakan dengan HDR yang lebih efisien adalah prioritas tinggi bagi masyarakat.

Teknik KO bersyarat khusus jaringan atau panggung penting untuk menentukan fokus gen

berfungsi pada organisme multiseluler. Beberapa strategi telah digunakan untuk menghasilkan mutasi bersyarat

di C. elegans, termasuk Cre-LoxP berbasis rekombinase spesifik situs (Flavell et al., 2013) dan Flp-FRT

sistem (Voutev dan Hubbard, 2008), atau jaringan dan RNAi spesifik tahap (Hannon, 2002). CRISPR-Cas9

sistem juga dapat digunakan untuk menghasilkan mutasi somatik dengan mengekspresikan Cas9 dalam sel somatik di bawah

kontrol yang dapat diinduksi (misalnya, promotor kejutan panas, hsp-16) atau spesifik jaringan (misalnya, neuronal, epidermal,

otot dan usus) promotor (Liu et al., 2014 Shen et al., 2014). Menariknya, dilaporkan bahwa

Aktivitas Cas9 dapat melintasi dari generasi ke generasi setelah transgen Cas9 somatik terbentuk (Shen et al.,

2014), dan yang terpenting mutasi somatik ini dapat diselamatkan dengan menyediakan protein fusi GFP (Li et al.,

2015). Melalui pembelahan DNA yang ditargetkan CRISPR-Cas9, metodologi ini memungkinkan penyelidikan terhadap

fungsi gen esensial dalam perkembangan postembrionik dan memberikan kemampuan untuk membedah jaringan

peran spesifik gen tunggal (Shen et al., 2014 Li et al., 2015 Tian et al., 2015). Studi ini juga

menunjukkan bahwa CRISPR-Cas9 somatik cepat, serbaguna, dan hemat biaya dibandingkan dengan yang lain

teknik knockout bersyarat. Namun, peringatannya adalah bahwa CRISPR-Cas9 somatik diperkenalkan

lesi molekuler cenderung heterogen dan biasanya tidak ditandai dengan baik pada tingkat DNA

urutan atau dalam distribusi seluler. Selanjutnya, sebagai mutasi yang diwariskan, efisiensi mutasi somatik

tampaknya sangat bervariasi antara gen dari 10% hingga 90% (Shen et al., 2014 Li et al., 2015), yang

mungkin tergantung pada desain sgRNA. Hasil negatif atau sebagian dengan pendekatan mutagenesis spesifik jaringan

saat ini harus diperlakukan dengan hati-hati.

Terlepas dari kekuatan dan keserbagunaan sistem CRISPR-Cas9, masalah serius adalah potensi

target pembelahan dan mutagenesis. CRISPR-Cas9 tampaknya menyebabkan tingkat off-target yang relatif tinggi

mutasi pada garis sel manusia (Fu et al., 2013 Hsu et al., 2013). Namun, yang menarik, itu adalah

menunjukkan bahwa mutagenesis yang diinduksi Cas9 sangat spesifik pada kedua embrio tikus (Wang et al.,

2013a Yang et al., 2013) dan sel iPS manusia (Smith et al., 2014 Veres et al., 2014). Selain itu, keseluruhan

sekuensing genom dan pemeriksaan lokus off-target yang dipilih belum menemukan efek off-target pada C.

elegans (Waaijers dan Boxem, 2014). Mutagenesis di luar target mungkin kurang menjadi masalah pada sel normal

(Singh et al., 2015), serta genom C. elegans yang lebih kecil dan kurang redundan. Meskipun risiko rendah

di luar target, fenotipe mutan yang dihasilkan oleh sistem CRISPR-Cas9 harus dianalisis dengan hati-hati,

dan spesifisitas target ini dapat ditentukan mengikuti aturan umum, seperti backcrossing, independen

alel yang dihasilkan melalui beberapa sgRNA, dan penyelamatan mutasi sinonim (Waaijers dan Boxem, 2014

Li dkk., 2015 Tian dkk., 2015).

PENINGKATAN EFISIENSI PENGEDITAN GENOM YANG DIMEDIASI CRISPR-CAS9

Terlepas dari beberapa laporan tentang mutagenesis yang sangat efisien, menjadi jelas bahwa efisiensi

Penargetan CRISPR-Cas9 dapat sangat bervariasi, dari gen ke gen dan antara sgRNA yang berbeda. Banyak usaha

sedang diterapkan untuk membedakan penyebab variasi ini dan untuk meningkatkan efisiensi reaksi. Sejak Cas9

pembelahan DNA yang ditargetkan hanya membutuhkan dua komponen (Cas9 dan sgRNA), strategi untuk ditingkatkan

efisiensi telah difokuskan pada peningkatan aktivitas Cas9 dan aktivitas pengikatan sgRNA.

Cas9 menghasilkan DSB ujung tumpul yang dekat dengan urutan PAM dalam proses yang dimediasi oleh dua nuklease

domain: HNH dan RuvC, yang membelah untai DNA komplementer dan nonkomplementer ke

sgRNA, masing-masing. Mutasi salah satu dari dua domain nuklease (H840A dalam HNH dan D10A dalam

RuvC) menghasilkan aktivitas nickase dari Cas9 (Cong et al., 2013 Jinek et al., 2012 Mali et al., 2013c), yang

menciptakan single stranded break (SSB) yang dapat diperbaiki melalui perbaikan eksisi dasar fidelitas tinggi (BER)

jalur (Dianov dan Hubscher, 2013). Beberapa penelitian pada mamalia dan Drosophila telah melaporkan bahwa

pendekatan double-nicking secara signifikan meningkatkan spesifisitas DSB sesuai target melalui offset nicking

(Mali et al., 2013a Ran et al., 2013 Port et al., 2014). Selain itu, dengan adanya template donor,

DNA yang dibelah oleh nickase ini lebih disukai diperbaiki oleh HDR daripada oleh NHEJ. Akibatnya,

penggunaan nickase Cas9 ini secara signifikan meningkatkan efisiensi HDR dengan mengorbankan NHEJ (Cong et

al., 2013 Mali et al., 2013c) dibandingkan dengan Cas9 tipe liar. Sampai saat ini, penggunaan nickase Cas9 belum

dilaporkan dalam C. elegans. Akan sangat menarik untuk mengeksplorasi apakah Cas9 nickases dapat meningkatkan

efisiensi penargetan melalui HDR di C. elegans. Tingkat ekspresi Cas9 juga mempengaruhi frekuensi

generasi mutan. Sebuah studi awal C. elegans menunjukkan konsentrasi tinggi ekspresi Cas9

plasmid dalam injeksi secara signifikan meningkatkan target mutasi (Friedland et al., 2013). Jadi, injeksi

mRNA atau protein yang disintesis secara in vitro dapat meningkatkan frekuensi mutagenesis target karena

dosis Cas9 yang lebih tinggi dalam inti germline dibandingkan dengan yang dicapai setelah injeksi pengkodean Cas9

plasmid (Tabel 1) (Chiu et al., 2013 Cho et al., 2013 Katic dan Grosshans, 2013).

Komponen penting dan kritis lainnya dari sistem CRISPR-Cas9 adalah RNA panduan tunggal, yang

menemukan dan mengikat ke lokus genom yang ditargetkan. Meningkatkan aktivitas pengikatan sgRNA dapat meningkatkan

Efisiensi pembelahan DNA berbasis CRISPR. Kemajuan terbaru pada mamalia dan C. elegans

percobaan menunjukkan bahwa sgRNA (E+F) yang dimodifikasi (E, ekstensi jepit rambut F, AU flip), mengandung

struktur jepit rambut pengikat Cas9 yang diperpanjang dan dihapus untuk terminator Pol III diduga (4 berturut-turut

U′s) dalam loop batang sgRNA oleh flip pasangan basa A-U, menampilkan peningkatan aktivitas (Chen et al., 2013a

Kelurahan, 2015). Temuan provokatif lain di C. elegans adalah bahwa RNA panduan dengan motif GG di 3'end'

dari sekuens spesifik target dapat secara dramatis meningkatkan frekuensi mutagenesis melalui kedua NHEJ

dan HDR (Farboud dan Meyer, 2015). Menggabungkan dua strategi ini untuk desain sgRNA mungkin lebih lanjut

meningkatkan frekuensi mutagenesis.

IDENTIFIKASI MUTASI MELALUI SELEKSI EFISIEN

Meskipun mutagenesis CRISPR-Cas9 bisa sangat efisien, sama pentingnya untuk meminimalkan

waktu dan tenaga yang dihabiskan untuk menemukan hewan mutan. Pengeditan genom yang dimediasi CRISPR-Cas9 dapat

diidentifikasi dengan teknik molekuler dasar seperti amplifikasi PCR dari situs yang mengelilingi DSB.

Amplikon PCR dari progeni F1 (dan penanda ko-injeksi positif) cacing kemudian dapat dianalisis menggunakan

endonuclease yang secara khusus mengenali DNA yang tidak cocok, seperti T7 endonuclease I atau CEL I.

juga relatif mudah untuk mengidentifikasi heterozigot untuk penghapusan yang dihasilkan oleh KO terarah sgRNA ganda

(Chen et al., 2014 Xu dan Chisholm, 2014). Dengan menambahkan situs pembatasan ke template donor, HDR

modifikasi genom berbasis dapat lebih mudah diidentifikasi dengan PCR diikuti oleh enzim pencernaan

(Dickinson et al., 2013 Paix et al., 2014). Mutasi yang tepat kemudian dapat dicari dengan sekuensing DNA.

Penting untuk dicatat bahwa setiap mutan yang diidentifikasi dalam PCR harus dikonfirmasi pada generasi berikutnya untuk

menghindari positif palsu karena mutasi somatik (Cho et al., 2013). Dalam kasus ketika efisiensi mutagenesis adalah

rendah, skrining PCR dari mutan F1 dapat menjadi padat karya. Baru-baru ini ditunjukkan bahwa deteksi

mutan yang ditargetkan dapat diuntungkan dari penyempurnaan dengan kombinasi genetika C. elegans. Beberapa

metode yang menjanjikan telah ditetapkan untuk mengeksploitasi fenotipe yang terlihat, resistensi terhadap terapi obat atau

pemilihan penanda, meminimalkan kerja langsung, waktu dan uang yang dihabiskan untuk pemeriksaan PCR

Seleksi fenotipe yang terlihat

Laporan awal pengeditan genom yang dimediasi CRISPR-Cas9 di C. elegans menguji gen yang kehilangan

fungsi terkenal memberikan fenotipe postembrionik resesif yang terlihat, seperti Unc atau Dpy.

Mutasi yang baru diinduksi dapat dengan mudah diidentifikasi dengan mengisolasi hewan transgenik F1 (diduga

heterozigot) dan memeriksa keturunan F2 mereka untuk fenotipe yang diharapkan (Friedland et al., 2013).

Beberapa makalah lain menjelaskan strategi serupa untuk mengisolasi mutan yang dihasilkan CRISPR (Chiu et al., 2013

Cho et al., 2013). Insertion mutations could in principle also be isolated by rescue of a visible phenotype

such as Unc (Dickinson et al., 2013), as successfully used in MosSCI mediated genome editing (Frokjaer-

Jensen et al., 2008 Dickinson et al., 2013). Thus, visible phenotype selection, if applicable, provides a

simple and powerful way to detect desired mutations.

Selection for antibiotic- or drug-resistance is a powerful means to find dominant resistant mutants.

Initially, several groups tested the efficiency of CRISPR-Cas9 targeted gene mutation using ben-1

(benomyl resistance-1) (Chen et al., 2013b Katic and Grosshans, 2013), encoding a tubulin whose loss-

of-function confers dominant resistance to benomyl. Comparable selections can also be used to identify

HDR events and simplify the screen strategy. Several exogenous antibiotic gene cassettes have been used

in C. elegans, such as neomycin, puromycin, hygromycin B and blasticidin. Selection and

counterselection strategies using HygR (hygromycin B-resistance gene) or BSD (blasticidin-resistance

gene) have been successfully applied to select animals with a transgene inserted by Cas9 via HDR (Chen

et al., 2013b Kim et al., 2014). In cases where HygR/BSD expression may disrupt the function of the

modified gene, the antibiotic gene cassette can be flanked with LoxP sites and removed by expression of

Cre recombinase. The delivery of Cre can be achieved either by subsequent microinjection of plasmid

(Dickinson et al., 2013), or by a heat-shock inducible promoter embedded in a self-excising drug selection

cassette (SEC) that was developed recently (Dickinson et al., 2015).

Fluorescence marker selection

C. elegans is effectively transparent, allowing fluorescence imaging in live animals and providing another

efficient positive selection strategy. Insertion of green fluorescent protein (GFP) to the CRISPR-Cas9

targeted site allows mutated animals to be identified by suitable fluorescence microcopy (Dickinson et al.,

2013 Tzur et al., 2013 Waaijers et al., 2013). Generated mutants in any fluorescence marker background

and identified morphology defects based on the fluorescence signal may provide another efficient way to

isolate the mutants. This simple selection strategy by visible fluorescent marker could significantly reduce

the hands-on screening work.

A hallmark of the natural CRISPR-Cas9 system is its ability to cleave multiple distinct targets

simultaneously and efficiently (Cong et al., 2013) within a single nucleus, the Cas9 protein can be

targeted to multiple genomic loci directed by different sgRNAs. Thus, use of a previously proven sgRNA

that results in an easily recognized visible phenotype may allow to identification of progeny of an animal

in which Cas9 was active. The validity of such multiplexing approaches is supported by the success of co-

CRISPR strategies, in which selection of animals with CRISPR-Cas9 induced NHEJ mutations at the unc-

22 locus enriched for CRISPR-Cas9 induced NHEJ events at a second unlinked locus (Kim et al., 2014).

This elegant co-CRISPR strategy not only significantly improved the frequency of detecting NHEJ events

(30%―80%), but also facilitated recovery of HDR events (10%―50%) (Kim et al., 2014). Such co-

CRISPR strategies should be very valuable in increasing efficiency in the generation of desired mutations,

and potentially without the necessity of extensive screening, or counter-selection.

Similar to co-CRISPR, in which CRISPR-Cas9 induced NHEJ mutation at the unc-22 locus increase the

efficient recovery of other NHEJ events (Kim et al., 2014), a co-conversion strategy was also invented to

efficiently recover HDR events in any gene in an otherwise unmarked genetic background (Arribere et al.,

2014). This strategy is also based on the idea that multiplex CRISPR of a marker gene, where HDR yields

an easily discernable phenotype, should enable identification of animals with the desired (unmarked)

mutation event, since such animals must have descended from a parental germline containing active Cas9,

guide RNA and donor DNA templates. Dominant mutations in morphological cuticle collagen genes such

as dpy-10(cn64), sqt-1(e1350) and rol-6(su1006) were induced and used to screen the F1 animals

(Arribere et al., 2014). In addition, rescue of a temperature sensitive lethal mutant pha-1(e2123) has also

been used as an alternate co-conversion selection marker for HDR events (Ward, 2015). In contrast to co-

conversion of dominant mutations, which does not depend on a specific genetic background, the pha-1(ts)

approach has to start with a mutant animal and results in restoration of a wild-type phenotype (Ward,

2015). These co-conversion methods significantly improved the efficiency up to 80% (Arribere et al.,

2014 Ward, 2015). The successes of these distinct variations of co-editing selection highlight the

robustness of CRISPR-Cas9 genome editing methods to detect the desired mutant. With this, it is

potential that any mutation of a gene could be made without any constraints on the genetic background,

minimizing the hands-on screening.

DESIGN CONSIDERATION AND IMPLMENTATION

It is less than two years since CRISPR-Cas9 was first reported in C. elegans, and the state of the art is in

rapid flux. Many variables and strategies have been tested in many laboratories, making it hard at times to

fairly compare the different approaches. However, some general considerations and advice can be put

forward. Based on the selection schemes summarized above, we can now design different approaches to

generate desired knock-ins and knock-outs, and some potential strategies are summarized in Table 3.

These approaches combine the advantages of current optimized selection methods. The main purpose of

all these strategies is: (1) to increase specificity and efficiency of mutagenesis, and (2) to minimize the

time and the hands-on labor needed to detect and recover mutants. As yet, no method can be absolutely

guaranteed to generate the desired mutation. Possibly the most important advice is that several different

sgRNAs should be tested using SUREYOR assay to compare the efficiency of the DNA cleavage, since

for any given gene or site a significant fraction of sgRNAs tested fail to induce any events (Arribere et al.,

2014 Kim et al., 2014). The basis of this variable effectiveness of sgRNAs remains unclear. The coupling

of optimized sgRNA design [3′ GG-guide RNA and sgRNA(E+F)] with co-CRISPR, co-conversion, or

recently designed SEC strategies may together strongly enhance mutagenesis and facilitate mutant

recovery (Dickinson et al., 2015 Farboud and Meyer, 2015).

The advent of CRISPR-Cas9 represents an effective next-generation method for programmable genome

editing, which will have significant impacts on future advancements in genetic manipulations in C.

elegans. It will change the way that we think of and perform the genetic and genomic analysis. Combined

with the power of C. elegans forward genetics, existing genetic mutants and powerful developmental

genetic tools that already available, the tractability of CRISPR-Cas9 offers researchers a versatile genome

editing tool to modify genes of interest. The CRISPR-Cas9 system is rapidly evolving, and fresh

developments are reported monthly. However, some applications of CRISPR-Cas9 have not been reported

in C. elegans. For example, catalytically inactive Cas9 fusion proteins can be targeted to specific DNA

loci to regulate gene transcription in other systems (Gilbert et al., 2013 Larson et al., 2013 Qi et al., 2013

Ji et al., 2014 Choudhary et al., 2015), but this inactive Cas9 regulated transcription has not been

described yet in C. elegans. CRISPR-Cas9 technology should also dramatically facilitate the use in other

nematodes lacking well-developed genetics, including species distantly related to C. elegans or parasitic

nematodes. A further application is to organelle inheritance. Mitochondria contain their own mtDNA

genomes and mitochondrial genetics is drastically different from the Mendelian genetics of nuclear genes.

mtDNA is present in multiple copies in different stage in C. elegans, ranging from

embryo and first three larvae stage to 780,000 copies in the adult stage (Lemire, 2005). Recently,

mitochondrial DNA has been mutated by mitochondrial-targeted TALENs (Bacman et al., 2013

Gammage et al., 2014 Reddy et al., 2015), suggesting potential ways to edit the mitochondrial genome.

Mitochondrial genome editing by Cas9 has not so far been reported, but may be another avenue for

CRISPR-Cas9 mediated targeted DNA editing not only in C. elegans but also in other systems. Indeed,

CRISPR-Cas9 significantly reduces the technological barrier for reverse genetics in any organism,

opening up a much wider arena for the genetic dissection of cellular processes.

I thank Dr. Andrew Chisholm for his critical reading and comments on this manuscript. I thank

Guangshuo Ou, Kyung Won Kim, Zhiping Wang and members of the Jin and Chisholm labs for

comments on the manuscript. S.X is an assistant project scientist in the Chisholm lab at the University of

California, San Diego. The work in the Dr. Andrew Chisholm’s lab is supported by National Institutes of

Health (NIH) grant R01 GM054657 to A.D.C.

Fig. 1. Diagram of CRISPR-Cas9 genome editing methodology in C. elegans.

Cas9 (dodger blue) and guided RNA (green) can be expressed in C. elegans germline by microinjecting

the mixture of plasmids, mRNA or combination of Cas9 protein and sgRNA mRNA. Successfully

expressed Cas9 and sgRNA will be assembled as a complex at its dsDNA target site. Two nuclease

domains RuvC and HNH cleave the DNA close to 5′ end of the PAM (yellow) sequence and generate

double-strand breaks (DSBs), which typically repaired by error-prone non-homologous end-joining

(NHEJ) or homology-directed repair (HDR). NHEJ can lead to the introduction of insertion/deletion

mutations (indels) (purple) of various lengths, which therefore disrupt gene function. HDR-mediated

repair can introduce specific point mutation or insert/delete desired sequences (red) through

recombination of the target locus with provided exogenous donor templates.

Arribere, J.A., Bell, R.T., Fu, B.X., Artiles, K.L., Hartman, P.S., Fire, A.Z., 2014. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198, 837-846.

Bacman, S.R., Williams, S.L., Pinto, M., Peralta, S., Moraes, C.T., 2013. Specific elimination of mutant mitochondrial genomes in patient-derived cells by mitoTALENs. Nat. Med. 19, 1111-1113.

Barstead, R.J., Moerman, D.G., 2006. C. elegans deletion mutant screening. Methods Mol. Biol. 351, 5158.

Bassett, A.R., Tibbit, C., Ponting, C.P., Liu, J.L., 2013. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4, 220-228.

Bassett, A.R., Liu, J.L., 2014. CRISPR/Cas9 and genome editing in Drosophila. J. Genet. Genomics 41, 7-19.

Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V., 2013. Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods 9, 39.

Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188, 773-782.

Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., Xi, J.J., 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465-472.

Chen, B., Gilbert, L.A., Cimini, B.A., Schnitzbauer, J., Zhang, W., Li, G.W., Park, J., Blackburn, E.H., Weissman, J.S., Qi, L.S., Huang, B., 2013a. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491.

Chen, C., Fenk, L.A., de Bono, M., 2013b. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res. 41, e193.

Chen, X., Xu, F., Zhu, C., Ji, J., Zhou, X., Feng, X., Guang, S., 2014. Dual sgRNA-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans. Sci. Rep. 4, 7581.

Cheng, Z., Yi, P., Wang, X., Chai, Y., Feng, G., Yang, Y., Liang, X., Zhu, Z., Li, W., Ou, G., 2013. Conditional targeted genome editing using somatically expressed TALENs in C. elegans. Nat. Biotechnol. 31, 934-937.

Chiu, H., Schwartz, H.T., Antoshechkin, I., Sternberg, P.W., 2013. Transgene-free genome editing in Caenorhabditis elegans using CRISPR-Cas. Genetics 195, 1167-1171.

Cho, S.W., Lee, J., Carroll, D., Kim, J.S., 2013. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195, 1177-1180.

Choudhary, E., Thakur, P., Pareek, M., Agarwal, N., 2015. Gene silencing by CRISPR interference in mycobacteria. Nat. Commun. 6, 6267.

Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.

Dianov, G.L., Hubscher, U., 2013. Mammalian base excision repair: the forgotten archangel. Nucleic Acids Res. 41, 3483-3490.

DiCarlo, J.E., Norville, J.E., Mali, P., Rios, X., Aach, J., Church, G.M., 2013. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, 4336-4343.

Dickinson, D.J., Ward, J.D., Reiner, D.J., Goldstein, B., 2013. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat. Methods 10, 1028-1034.

Dickinson, D.J., Pani, A.M., Heppert, J.K., Higgins, C.D., Goldstein, B., 2015. Streamlined genome engineering with a self-excising drug selection cassette. Genetics doi:10.1534/genetics.115.178335

Doudna, J.A., Charpentier, E., 2014. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096.

Edgley, M., D'Souza, A., Moulder, G., McKay, S., Shen, B., Gilchrist, E., Moerman, D., Barstead, R., 2002. Improved detection of small deletions in complex pools of DNA. Nucleic Acids Res. 30, e52.

Farboud, B., Meyer, B.J., 2015. Dramatic enhancement of genome editing by CRISPR/Cas9 through improved guide RNA design. Genetics 199, 959-971.

Flavell, S.W., Pokala, N., Macosko, E.Z., Albrecht, D.R., Larsch, J., Bargmann, C.I., 2013. Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans. Cell 154, 1023-1035.

Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiacovo, M.P., Church, G.M., Calarco, J.A., 2013. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat. Methods 10, 741-743.

Frokjaer-Jensen, C., 2013. Exciting prospects for precise engineering of Caenorhabditis elegans genomes with CRISPR/Cas9. Genetics 195, 635-642.

Frokjaer-Jensen, C., Davis, M.W., Ailion, M., Jorgensen, E.M., 2012. Improved Mos1-mediated transgenesis in C. elegans. Nat. Methods 9, 117-118.

Frokjaer-Jensen, C., Davis, M.W., Hollopeter, G., Taylor, J., Harris, T.W., Nix, P., Lofgren, R., Prestgard-Duke, M., Bastiani, M., Moerman, D.G., Jorgensen, E.M., 2010. Targeted gene deletions in C. elegans using transposon excision. Nat. Methods 7, 451-453.

Frokjaer-Jensen, C., Davis, M.W., Hopkins, C.E., Newman, B.J., Thummel, J.M., Olesen, S.P., Grunnet, M., Jorgensen, E.M., 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nat. Genet. 40, 1375-1383.

Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., Sander, J.D., 2013. Highfrequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 31, 822-826.

Gammage, P.A., Rorbach, J., Vincent, A.I., Rebar, E.J., Minczuk, M., 2014. Mitochondrially targeted ZFNs for selective degradation of pathogenic mitochondrial genomes bearing large-scale deletions or point mutations. EMBO Mol. Med. 6, 458-466.

Gengyo-Ando, K., Mitani, S., 2000. Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 269, 64-69.

Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., Lim, W.A., Weissman, J.S., Qi, L.S., 2013. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451.

Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M., Wildonger, J., O'Connor-Giles, K.M., 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194, 1029-1035.

Hannon, G.J., 2002. RNA interference. Nature 418, 244-251.

Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278.

Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., Zhang, F., 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827-832.

Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K., Peterson, R.T., Yeh, J.R., 2013. Heritable and precise zebrafish genome editing using a CRISPR-Cas system. PLoS One 8, e68708.

Ji, W., Lee, D., Wong, E., Dadlani, P., Dinh, D., Huang, V., Kearns, K., Teng, S., Chen, S., Haliburton, J., Heimberg, G., Heineike, B., Ramasubramanian, A., Stevens, T., Helmke, K.J., Zepeda, V., Qi, L.S., Lim, W.A., 2014. Specific gene repression by CRISPRi system transferred through bacterial conjugation. ACS Synth. Biol. 3, 929-931.

Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E., 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.

Katic, I., Grosshans, H., 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195, 1173-1176.

Kim, H., Ishidate, T., Ghanta, K.S., Seth, M., Conte, D., Jr., Shirayama, M., Mello, C.C., 2014. A coCRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197, 1069-1080.

Larson, M.H., Gilbert, L.A., Wang, X., Lim, W.A., Weissman, J.S., Qi, L.S., 2013. CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat. Protoc. 8, 2180-2196.

Lemire, B., 2005. Mitochondrial genetics. WormBook, 1-10.

Li, W., Teng, F., Li, T., Zhou, Q., 2013. Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat. Biotechnol. 31, 684-686.

Li, W., Yi, P., Ou, G., 2015. Somatic CRISPR-Cas9-induced mutations reveal roles of embryonically essential dynein chains in Caenorhabditis elegans cilia. J. Cell Biol. 208, 683-692.

Liu, P., Long, L., Xiong, K., Yu, B., Chang, N., Xiong, J.W., Zhu, Z., Liu, D., 2014. Heritable/conditional genome editing in C. elegans using a CRISPR-Cas9 feeding system. Cell Res. 24, 886-889.

Lo, T.W., Pickle, C.S., Lin, S., Ralston, E.J., Gurling, M., Schartner, C.M., Bian, Q., Doudna, J.A., Meyer, B.J., 2013. Precise and heritable genome editing in evolutionarily diverse nematodes using TALENs and CRISPR/Cas9 to engineer insertions and deletions. Genetics 195, 331-348.

Ma, Y., Zhang, X., Shen, B., Lu, Y., Chen, W., Ma, J., Bai, L., Huang, X., Zhang, L., 2014. Generating rats with conditional alleles using CRISPR/Cas9. Cell Res. 24, 122-125.

Maggio, I., Goncalves, M.A., 2015. Genome editing at the crossroads of delivery, specificity, and fidelity. Trends Biotechnol. 33, 280-291.

Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., Church, G.M., 2013a. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol. 31, 833-838.

Mali, P., Esvelt, K.M., Church, G.M., 2013b. Cas9 as a versatile tool for engineering biology. Nat. Methods 10, 957-963.

Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church, G.M., 2013c. RNA-guided human genome engineering via Cas9. Science 339, 823-826.

Paix, A., Wang, Y., Smith, H.E., Lee, C.Y., Calidas, D., Lu, T., Smith, J., Schmidt, H., Krause, M.W., Seydoux, G., 2014. Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics 198, 1347-1356.

Plasterk, R.H., Groenen, J.T., 1992. Targeted alterations of the Caenorhabditis elegans genome by transgene instructed DNA double strand break repair following Tc1 excision. Embo J. 11, 287-290.

Port, F., Chen, H.M., Lee, T., Bullock, S.L., 2014. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Prok. Natal akad. Sci. USA 111, E2967-2976.

Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P., Lim, W.A., 2013. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183.

Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., Zhang, F., 2013. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389.

Reddy, P., Ocampo, A., Suzuki, K., Luo, J., Bacman, S.R., Williams, S.L., Sugawara, A., Okamura, D., Tsunekawa, Y., Wu, J., Lam, D., Xiong, X., Montserrat, N., Esteban, C.R., Liu, G.H., Sancho-Martinez, I., Manau, D., Civico, S., Cardellach, F., Del Mar O'Callaghan, M., Campistol, J., Zhao, H., Campistol, J.M., Moraes, C.T., Izpisua Belmonte, J.C., 2015. Selective elimination of mitochondrial mutations in the germline by genome editing. Cell 161, 459-469.

Robert, V., Bessereau, J.L., 2007. Targeted engineering of the Caenorhabditis elegans genome following Mos1-triggered chromosomal breaks. Embo J. 26, 170-183.

Segal, D.J., Meckler, J.F., 2013. Genome engineering at the dawn of the golden age. annu. Rev. Genomics Hum. Genet. 14, 135-158.

Shen, Z., Zhang, X., Chai, Y., Zhu, Z., Yi, P., Feng, G., Li, W., Ou, G., 2014. Conditional knockouts generated by engineered CRISPR-Cas9 endonuclease reveal the roles of coronin in C. elegans neural development. Dev. Cell 30, 625-636.

Singh, P., Schimenti, J.C., Bolcun-Filas, E., 2015. A mouse geneticist's practical guide to CRISPR applications. Genetics 199, 1-15.

Smith, C., Gore, A., Yan, W., Abalde-Atristain, L., Li, Z., He, C., Wang, Y., Brodsky, R.A., Zhang, K., Cheng, L., Ye, Z., 2014. Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs. Cell Stem Cell 15, 12-13.

Tian, D., Diao, M., Jiang, Y., Sun, L., Zhang, Y., Chen, Z., Huang, S., Ou, G., 2015. Anillin Regulates Neuronal migration and neurite growth by linking RhoG to the actin cytoskeleton. Curr. Biol. 25, 11351145.

Tzur, Y.B., Friedland, A.E., Nadarajan, S., Church, G.M., Calarco, J.A., Colaiacovo, M.P., 2013. Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR-Cas9 system. Genetics 195, 1181-1185.

Veres, A., Gosis, B.S., Ding, Q., Collins, R., Ragavendran, A., Brand, H., Erdin, S., Cowan, C.A., Talkowski, M.E., Musunuru, K., 2014. Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing. Cell Stem Cell 15, 27-30.

Voutev, R., Hubbard, E.J., 2008. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. Genetics 180, 103-119.

Waaijers, S., Boxem, M., 2014. Engineering the Caenorhabditis elegans genome with CRISPR/Cas9. Methods 68, 381-388.

Waaijers, S., Portegijs, V., Kerver, J., Lemmens, B.B., Tijsterman, M., van den Heuvel, S., Boxem, M., 2013. CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans. Genetics 195, 1187-1191.

Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., Jaenisch, R., 2013a. Onestep generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918.

Wang, Y., Li, Z., Xu, J., Zeng, B., Ling, L., You, L., Chen, Y., Huang, Y., Tan, A., 2013b. The CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell Res. 23, 1414-1416.

Ward, J.D., 2015. Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co-conversion and inactivation of NHEJ repair. Genetics 199, 363-377.

Wei, C., Liu, J., Yu, Z., Zhang, B., Gao, G., Jiao, R., 2013. TALEN or Cas9 - rapid, efficient and specific choices for genome modifications. J. Genet. Genomics 40, 281-289.

Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., Meyer, B.J., 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333, 307.

Xu, S., Chisholm, A.D., 2014. C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair. Dev. Cell 31, 48-60.

Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., Jaenisch, R., 2013. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell 154, 1370-1379.

Yu, Z., Ren, M., Wang, Z., Zhang, B., Rong, Y.S., Jiao, R., Gao, G., 2013. Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 195, 289-291.

Zhao, P., Zhang, Z., Ke, H., Yue, Y., Xue, D., 2014. Oligonucleotide-based targeted gene editing in C. elegans via the CRISPR/Cas9 system. Cell Res. 24, 247-250.


Bahan dan metode

C. elegan strains

The Bristol strain N2 was used as the standard wild-type strain. 27 The following mutant alleles were used in this work: unc-46(e177), mdf-1(gk2), dpy-5(s1300), dog-1(gk10), dhc-1(or283ts), dpy-10(e128), dpy-17(e164), dpy-13(e184), unc-119(ed3), ttTi5605, dotSi100, cxTi10882, dotSi110, such-4(h2168) and nT1[let-?(m435)]. The following strains were used in this work: N2 (Bristol strain as a wild-type), KR4233 [unc-46(e177) mdf-1(gk2) such-4(h2168)] KR3627 [unc-46(e177) mdf-1(gk2) V/nT1[let-?(m435)])] VC13 [dog-1(gk10)] EU1385 [dhc-1(or283ts)] JNC100 [unc-119(ed3) I dotSi100 II (T06E6.2 + unc-119(+)]] AZ212 [unc-119(ed3) ruIs32[unc-119(+) pie-1∷GFP∷H2B] III] and JNC144 [unc-119(ed3) I dotSi110 IV (T06E6.2 + unc-119(+)]]. Additional strains used in this work were generated in this study. Strains were maintained using standard protocol on nematode growth media (NGM) plates seeded with OP50 bacteria. 27 The strains were maintained at 20°C, while the phenotypic analyses were performed at both 20°C and 25°C as noted in the results section.

Mutation accumulation procedure and phenotypic analysis

The first suppressor, such-4, was isolated as previously described. 9 One clone from this strain, unc-46 mdf-1 such-4 dog-1 was outcrossed from the dog-1(gk10) background to avoid further accumulation of mutations and the KR4233 [mdf-1(gk2) such-4(h2168)] was generated and analyzed. 10,13 The second strain (JNC170) was maintained at 20ºC for 470 generations to allow further accumulation of mutations. Each generation 5 L4 hermaphrodites were transferred to a fresh plate. We also froze the worms at generations 170 (JNC168) and 270 JNC169). Then, at F170, F270 dan F470 phenotypic analysis was performed for each strain. Ten L4 hermaphrodites were plated individually and analyzed for number of embryonic arrests, larval arrests, adults and fertile adults, as described previously. 9 In total, 5 to eight trials per strain were performed and SEM (standard error of the mean) was calculated and represented as error bars. Note that mdf-1(gk2) is linked to unc-46(e177) which results in an uncoordinated (Unc) phenotype and allows visual identification of mdf-1(gk2) homozygotes.

Genetic analysis of the unc-46 mdf-1 such-4 dog-1F470 genom

To map suppressor mutations to a chromosome, we used Dpy (Dumpy) markers located in the central regions of the autosomes. To identify candidate genes in the mapped regions, we combined WGS and oaCGH analyses. Genomic DNA was prepared from JNC168, JNC169 and JNC170 following a standard protocol (http://www.genetics.wustl.edu/tslab/Protocols/genomic_DNA_prep.htm) originally set up by Andy Fire's Laboratory. For the WGS, using Illumina Solexa technology, libraries were prepared and sequenced at Canada's Michael Smith Genome Sciences Center for JNC170 and Simon Fraser University for JNC168 and JNC169. oaCGH analysis was performed as described by Maydan and colleagues 28 using the newly designed 3-plex microarray (120618_Cele_WS230_JK_CGH), manufactured by Roche NimbleGen Inc. Detailed methods on bioinformatics analysis of the WGS and oaCGH data will be published separately.

Phenotypic analysis of dhc-1

dhc-1(dot168) was separated from other accumulated mutations in the unc-46 mdf-1 such-4 dog-1F470 genome by extensive backcrossing to N2 and using the tetra-primer ARMS-PCR 20 to select for dhc-1(dot168) homozygotes after each backcross. The following primers were designed and used for tetra-primer ARMS-PCR: C allele: AGCAAAGGAAAGATTCTTGATGATAAGTC T allele: TCTTCAGTTTTTCGAGAGTTTCAATAAACA Out_F:CCAGATCTTTATGATCACTCGTGATTC Out_R:AATCTCATTGAGCTGTTGTAGAGTGTGA. Using these primers, homozygous dhc-1(dot168) is recognizable by 2 PCR-bands, 439 bp of the 2 outer primers and 299 bp of the mutant allele N2 homozygotes also produce the 439 bp band, but a 199 bp band for the wild-type allele heterozygotes produce 3 bands (439 bp, 299 bp and 199 bp). First, JNC170 was crossed to N2 and dhc-1(dot168) homozygotes that did not have unc-46(e177) mdf-1(gk2), dog-1(gk10) dan such-4(h2168) alleles were selected. Then these dhc-1(dot168) homozygotes were backcrossed to N2 worms an additional 9 times. After each outcross, homozygous dhc-1(dot168) animals were selected. After the final outcross phenotypic analyses and genetic interaction studies were performed.

To assess whether dhc-1(dot168) dan dhc-1(or283ts) could suppress the lethality and sterility of mdf-1(gk2), the F1 mdf-1(gk2) homozygotes, segregated from KR3627 (unc-46(e177) mdf-1(gk2) V/nT1[let-?(m435)]) strain were mated to either dhc-1(dot168) atau dhc-1(or283ts) males. The phenotypically wild-type l unc-46(e177) mdf-1(gk2)/ + + dhc-1/ + hermaphrodites were allowed to self-fertilize and Unc-46 progeny were plated individually. All of the worms that propagated for more than 3 generations were genotyped and confirmed to be homozygous for dhc-1, while none of the worms that did not be propagated for longer than 3 generations were homozygous for dhc-1.

To construct unc-46(e177) mdf-1(gk2) such-4(h2168) dhc-1(dot168) we mated dhc-1(dot168) males to KR4233 (unc-46(e177) mdf-1(gk2) such-4(h2168)) hermaphrodites and screened for Unc-46 worms. The Unc-46 worms were then analyzed using PCR and gk2, h2168, dot168 homozygotes were kept. The primers and procedure used to track gk2 dan h2168 homozygotes were published previously. 9,10 Using the MosSCI method 23 we generated a strain (JNC100) that contains 2 copies of cyb-3 gene. 10 To eliminate the possibility that potential background mutations in KR4233 would interfer with our results, we also constructed unc-46(e177) mdf-1(gk2) dhc-1(dot168) cyb-3 dup (dotSi100). Analysis of this strain revealed similar results to the unc-46(e177) mdf-1(gk2) such-4(h2168) dhc-1(dot168) strain (data not shown). To construct unc-46(e177) mdf-1(gk2) cyb-3(dotSi100) cyb-3(dotSi110) dhc-1(dot168) we mated dhc-1(dot168) males to unc-46(e177) mdf-1(gk2) cyb-3(dotSi100) cyb-3(dotSi110) hermaphrodites then screened for Unc-46 worms. The Unc-46 worms were then analyzed using PCR and gk2, dotSi100, dotSi110, dot168 homozygotes were kept. The primers and procedure used to track dotSi100, dotSi110 homozygotes were published previously. 10,24

Phenotypic analysis of the constructed strains was performed as follows hermaphrodites at L4 stage were grown on fresh OP50 plates at 20⁰C or 25⁰C. The hermaphrodites were transferred to fresh plates every 12 hours. Brood size was calculated based on the total eggs laid by each hermaphrodite. Embryos that did not hatch were scored as embryonic arrests, while the embryos that hatched but did not grow to adult stage were scored as larval arrests. The embryos that developed into adults were analyzed for the presence of males in all the strains analyzed, while all the mdf-1(gk2)-allele containing strains were also analyzed for the percent of the sterile adult progeny by individually plating all the adult progeny and scoring the presence or absence of offspring.

Anaphase onset timing in the early embryo

One-day old gravid adult hermaphrodites were dissected and embryos were mounted onto 3% agarose pads as described previously. 29 Embryos were observed using a Quorum WaveFX Spinning Disk system mounted on Zeiss Axioplan microscope. Early embryonic cell division was recorded using time-lapse video microscopy at 400x, with 200 ms fluorescent exposure, one image every 10 seconds. Image acquisition and analysis was performed using the Volocity software package.

QRT-PCR

qRT-PCR analysis was performed on genomic DNA from wild-type (N2), KR4233, JNC168, JNC169 and JNC170. Three internal references were used, eif-3, cdc-42 and mdh-1 following the procedures described previously. 30 Mean values and standard deviations of relative ratios from four replicates are shown. Each qRT-PCR reaction contained 50 ng of genomic DNA, 10 μL of 2x SYBR Green Supermix (Biorad), and 1 μM of each primer. qRT-PCR reactions were run in quadruplicate on a Biorad MyIQ Real-time thermocycler. Data were normalized using the 3 internal references and the relative fold change was calculated using the ΔΔCt method. All primers were tested on serial dilutions and primer efficiency was calculated.

Table 1. dhc-1 suppresses mdf-1(gk2) lethality and sterility


Kesimpulan

Molting is a complex developmental process that is carried out in all nematodes, as well as in many other invertebrate species. Molting allows for the replacement of the apical ECM, known as the cuticle, thereby enabling growth or developmental specialization. As described above, a large and diverse collection of genes have been implicated in molting control in C. elegan (Table 1). However, a clear and integrated description of the molting cascade is still missing within nematode species. Further studies will undoubtedly lead to a better understanding of this important developmental process.

Beyond an interest in understanding molting as a developmental process, molting studies may have other significant and practical applications. Notably, molting is a potential focus for antihelminthic drug development, both for human and veterinary medicine. 143-145 Diseases caused by nematodes are still widely distributed in the human population and affect hundreds of millions of people, according to the World Health Organization. 146 Nematode infections can lead to a number of long-term consequences, including death, and can further complicate other diseases. Many of these diseases are zoonoses, meaning that they are naturally transmissible from vertebrate animals to humans. Correspondingly, nematode infections of animals, as well as plants, have significant economic consequences. 147,148 As such, agricultural industries use extensive prophylactic measures to decrease the prevalence of parasitic nematodoses, which cause material damage and financial loss.

Although molting in nematodes might seem to constitute a specialized biological process within invertebrates, understanding the molecular basis for ECM remodeling and other fundamental events associated with molting has broad relevance for biology and our basic knowledge of disease states. Furthermore, because the C. elegan cuticle is largely collagen based, it is potentially useful for understanding dermal physiology and wound healing in higher eukaryotes. 149 In addition, primary tumor invasion through the ECM is an important process during tumor metastasis and shares many conserved features with ECM remodeling. 150-152 Notably, many genes implicated in C. elegan molting have orthologs in higher eukaryotes, indicating that this biological system represents a powerful tool for exploring the functions and molecular mechanisms underlying a wide range of conserved cellular and developmental processes.

Table 1. C. elegan genes implicated in molting that are discussed in this review.


Tonton videonya: MEGA SUMMER HACKS For Smart Parents (Agustus 2022).