Informasi

Mengenai nukleotida yang berbeda pada untai DNA

Mengenai nukleotida yang berbeda pada untai DNA



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Saya bukan ahli biologi karena itu, mungkin tampak sebagai pertanyaan mendasar. Saya mengambil urutan hewan pengerat dari database UTR:

http://utrdb.ba.itb.cnr.it

Dan saya tahu seharusnya ada empat nukleotida yaitu: A,G,C, dan T. Namun, pada database ini saya mendapatkan urutan yang memiliki 'n' nukleotida di beberapa lokasi, 'm' dan 'k' juga. Apa arti dari huruf-huruf ini? Saya belum dapat menemukan apa pun tentang itu. Apakah ini berarti posisi-posisi ini dalam UTR tidak terdefinisi atau mereka adalah beberapa nukleotida 'perantara' jika ada?


Ini adalah kode IUPAC untuk apa yang disebut basa "merosot" atau ambigu, alternatif dari yang biasaA,T,C, danGnukleotida (untuk DNA). NSnkode mewakili basis apa pun, sementaraMdanKpeta keAatauC, danGatauT, masing-masing.


7.1: Struktur DNA

  • Disumbangkan oleh E. V. Wong
  • Axolotl Academica Publishing (Biologi) di Axolotl Academica Publishing

Seperti yang Anda lihat pada Gambar1, nukleotida hanya sedikit berbeda, dan hanya dalam basa nitrogen. Dalam kasus DNA, basa tersebut adalah adenin, guanin, sitosin, dan timin. Perhatikan kesamaan bentuk adenin dan guanin, dan juga kesamaan antara sitosin dan timin. A dan G diklasifikasikan sebagai purin, sedangkan C dan T diklasifikasikan sebagai pirimidin. Selama kita memberi nama sesuatu, perhatikan &ldquodeoxyribose&rdquo dan &ldquoribose&rdquo. Seperti namanya, deoksiribosa hanyalah ribosa tanpa oksigen. Lebih khusus, di mana ada gugus hidroksil yang terikat pada 2-karbon ribosa, hanya ada hidrogen yang terikat pada 2-karbon deoksiribosa. Itulah satu-satunya perbedaan antara kedua gula.

Dalam membangun untai tunggal asam nukleat secara acak in vitro, tidak ada aturan khusus mengenai urutan nukleotida sehubungan dengan basanya. Identitas basa nitrogennya tidak relevan karena nukleotida terikat oleh ikatan fosfodiester melalui gugus fosfat dan pentosa. Oleh karena itu sering disebut sebagai tulang punggung gula-fosfat. Jika kita menguraikan kata &ldquofosfodiester&rdquo, kita akan melihat bahwa kata tersebut dengan mudah menggambarkan hubungannya: gula dihubungkan oleh dua ikatan ester ( &mdashO&mdash) dengan fosfor di antaranya. Salah satu gagasan yang sering membingungkan siswa adalah arah ikatan ini, dan oleh karena itu, asam nukleat secara umum. Misalnya, ketika kita berbicara tentang DNA polimerase, enzim yang mengkatalisis penambahan nukleotida dalam sel hidup, kita mengatakan bahwa ia bekerja dalam arah 5-prima (5&rsquo) hingga 3-prima (3&rsquo). Ini mungkin tampak seperti pembicaraan ahli biologi molekuler yang misterius, tetapi sebenarnya sangat sederhana. Perhatikan lagi dua nukleotida yang disatukan oleh ikatan fosfodiester (Gambar (PageIndex<1>), kiri bawah). Sebuah nukleotida adenin bergabung dengan nukleotida sitosin. Ikatan fosfodiester akan selalu menghubungkan 5-karbon dari satu deoksiribosa (atau ribosa dalam RNA) ke 3-karbon dari gula berikutnya. Ini juga berarti bahwa pada salah satu ujung rantai nukleotida terkait, akan ada fosfat 5&rsquo (-PO4), dan di ujung yang lain, 3 hidroksil (-OH) bebas. Ini menentukan arah untai DNA atau RNA.

Gambar (PageIndex<1>). DNA. Asam deoksiribonukleat adalah rantai polimer nukleotida yang dihubungkan oleh ikatan fosfodiester 5 hingga 3. DNA biasanya ada sebagai dua untai komplementer antiparalel yang disatukan oleh ikatan hidrogen antara adenin (A) dan timin (T), dan antara guanin (G) dan sitosin (C).

DNA biasanya ditemukan sebagai molekul beruntai ganda dalam sel sedangkan RNA sebagian besar beruntai tunggal. Penting untuk dipahami meskipun, bahwa di bawah kondisi yang sesuai, DNA dapat dibuat beruntai tunggal, dan RNA dapat beruntai ganda. Faktanya, molekulnya sangat mirip sehingga memungkinkan untuk membuat molekul hibrid beruntai ganda dengan satu untai DNA dan satu RNA. Menariknya, heliks ganda RNA-RNA dan heliks ganda RNA-DNA sebenarnya sedikit lebih stabil daripada heliks ganda DNA-DNA yang lebih konvensional.

Dasar dari sifat untai ganda DNA, dan sebenarnya dasar dari asam nukleat sebagai media untuk penyimpanan dan transfer informasi genetik, adalah pasangan basa. Pasangan basa mengacu pada pembentukan ikatan hidrogen antara adenin dan timin, dan antara guanin dan sitosin. Pasangan ini secara signifikan lebih stabil daripada asosiasi apa pun yang terbentuk dengan basis lain yang mungkin. Selanjutnya, ketika asosiasi pasangan basa ini terbentuk dalam konteks dua untai asam nukleat, jaraknya juga seragam dan sangat stabil. Anda mungkin ingat bahwa ikatan hidrogen adalah ikatan yang relatif lemah. Namun, dalam konteks DNA, ikatan hidrogen inilah yang membuat DNA sangat stabil dan oleh karena itu sangat cocok sebagai media penyimpanan jangka panjang untuk informasi genetik. Karena bahkan dalam prokariota sederhana, heliks ganda DNA setidaknya memiliki panjang ribuan nukleotida, ini berarti ada beberapa ribu ikatan hidrogen yang menahan kedua untaian bersama-sama. Meskipun setiap interaksi ikatan hidrogen nukleotida-ke-nukleotida individu dapat dengan mudah terganggu sementara oleh sedikit peningkatan suhu, atau perubahan kecil dalam kekuatan ionik larutan, heliks ganda penuh DNA membutuhkan suhu yang sangat tinggi (umumnya lebih dari 90 o C) untuk sepenuhnya mendenaturasi heliks ganda menjadi untaian individu.

Karena ada pasangan nukleotida satu-satu yang tepat, ternyata kedua untai pada dasarnya adalah salinan cadangan satu sama lain - jaring pengaman jika nukleotida hilang dari satu untai. Faktanya, bahkan jika bagian dari kedua untai rusak, selama untai lainnya utuh di area kerusakan, maka informasi penting masih ada dalam urutan pelengkap dari untai yang berlawanan dan dapat ditulis pada tempatnya. Namun perlu diingat, bahwa sementara satu untai DNA dapat bertindak sebagai &ldquobackup&rdquo&rdquo dari yang lain, kedua untaian tidak identik - mereka saling melengkapi. Konsekuensi menarik dari sistem untai komplementer dan antiparalel ini adalah bahwa kedua untai masing-masing dapat membawa informasi unik.

Pasangan gen dua arah adalah dua gen pada untaian DNA yang berlawanan, tetapi berbagi promotor, yang terletak di antara keduanya. Karena DNA hanya dapat dibuat dalam satu arah, 5&rsquo hingga 3&rsquo, promotor dua arah ini, sering kali merupakan pulau CpG (lihat bab berikutnya), dengan demikian mengirimkan RNA polimerase untuk setiap gen dalam arah fisik yang berlawanan. Ini telah ditunjukkan untuk sejumlah gen yang terlibat dalam kanker (payudara, ovarium), dan merupakan mekanisme untuk mengoordinasikan ekspresi jaringan produk gen.

Untaian heliks ganda DNA adalah antiparalel. Ini berarti bahwa jika kita melihat heliks ganda DNA dari kiri ke kanan, satu untai akan dibangun dalam arah 5&rsquo ke 3&rsquo, sedangkan untai komplementer dibangun dalam arah 3&rsquo ke 5&rsquo. Ini penting untuk fungsi enzim yang membuat dan memperbaiki DNA, seperti yang akan segera kita bahas. Pada Gambar (PageIndex<1>), untai kiri adalah 5&rsquo hingga 3&rsquo dari atas ke bawah, dan yang lainnya adalah 5&rsquo hingga 3&rsquo dari bawah ke atas.

Dari sudut pandang fisik, molekul DNA bermuatan negatif (semua fosfat itu), dan biasanya heliks ganda dengan putaran tangan kanan. Dalam keadaan normal (juga disebut konformasi &ldquoB&rdquo), satu putaran penuh molekul meliputi 11 pasangan basa, dengan 0,34 nm di antara setiap basa nukleotida. Setiap basa nitrogen adalah planar, dan ketika dipasangkan dengan basa komplementer, membentuk &ldquorung&rdquo at planar pada &ldquoladder&rdquo DNA. Ini tegak lurus terhadap sumbu longitudinal DNA. Sebagian besar DNA yang mengambang bebas di dalam sel, dan sebagian besar DNA dalam larutan berair dengan osmolaritas dan pH mendekati fisiologis, ditemukan dalam konformasi B ini. Namun, konformasi lain telah ditemukan, biasanya dalam keadaan lingkungan yang sangat spesifik. Konformasi terkompresi, A-DNA, diamati sebagai artefak dari in vitro kristalisasi, dengan sedikit lebih banyak basa per putaran, panjang putaran lebih pendek, dan pasangan basa yang tidak tegak lurus terhadap sumbu longitudinal. Yang lain, Z-DNA, tampaknya terbentuk secara sementara dalam bentangan DNA yang kaya GC di mana, yang menarik, DNA memutar ke arah yang berlawanan.

Gambar (PageIndex<2>). Tiga konformasi DNA. B-DNA paling umum, A-DNA kemungkinan merupakan artefak kristalisasi in vitro, dan Z-DNA dapat terbentuk secara sementara di bagian kromosom.

Telah dikemukakan bahwa baik bentuk A dan Z DNA, pada kenyataannya, relevan secara fisiologis. Ada bukti yang menunjukkan bahwa bentuk A dapat terjadi pada heliks ganda hibrid RNA-DNA serta ketika DNA dikomplekskan dengan beberapa enzim. Konformasi Z dapat terjadi sebagai respons terhadap metilasi DNA. Lebih jauh lagi, konformasi B-DNA &ldquonormal&rdquo adalah sesuatu dari struktur ideal berdasarkan hidrasi penuh, seperti yang sangat mungkin terjadi di dalam sel. Namun, keadaan hidrasi itu terus berubah, meskipun sangat kecil, sehingga konformasi DNA akan sering sedikit berbeda dari parameter konformasi B pada Gambar (PageIndex<2>).

Pada prokariota, DNA ditemukan di sitoplasma (agak jelas karena tidak ada pilihan lain pada organisme sederhana itu), sedangkan pada eukariota, DNA ditemukan di dalam nukleus. Terlepas dari perbedaan lokasi, tingkat perlindungan dari kekuatan eksternal, dan yang terpenting, ukurannya, DNA prokariotik dan eukariotik dikemas dengan protein yang membantu mengatur dan menstabilkan keseluruhan struktur kromosom. Relatif sedikit yang dipahami sehubungan dengan pengemasan kromosom prokariotik meskipun ada kesamaan struktural antara beberapa protein yang ditemukan pada kromosom prokariotik dan eukariotik. Oleh karena itu, sebagian besar kursus biologi sel pengantar menempel pada kemasan kromosom eukariotik.

Gambar (PageIndex<3>). kemasan DNA. (A) Untaian DNA telanjang berdiameter kira-kira 2 nm. (B) Histon, yang merupakan protein oktamerik yang digambarkan di sini sebagai protein silindris kasar, memiliki muatan positif yang didistribusikan di permukaan luar untuk berinteraksi dengan tulang punggung DNA bermuatan negatif. (C) Bahkan organisasi yang diberikan oleh pengikatan histon dapat meninggalkan jalinan DNA yang tidak dapat diatur, terutama dengan genom eukariotik yang lebih panjang, dan oleh karena itu DNA yang terikat histon dikemas ke dalam &ldquo30-nm strand&rdquo. Ini disatukan, sebagian, oleh interaksi histone. (D) Serat 30 nm dilingkarkan menjadi serat 700 nm, yang dengan sendirinya dibentuk menjadi kromosom eukariotik tipikal (E).

DNA telanjang, apakah prokariotik atau eukariotik, adalah untaian bahan yang sangat tipis, berdiameter sekitar 11 nm. Namun, mengingat ukuran genom eukariotik, jika DNA disimpan seperti itu di dalam nukleus, itu akan menjadi kusut tak terkendali. Bayangkan sebuah ember di mana Anda telah melemparkan benang sepanjang seratus meter tanpa upaya apa pun untuk mengaturnya dengan melilitkannya atau mengikatnya. Sekarang pertimbangkan apakah Anda akan dapat meraih ke dalam tarikan ember itu pada satu untai, dan berharap untuk menarik hanya satu untai, atau jika sebaliknya Anda cenderung menarik setidaknya seutas benang kecil. Sel pada dasarnya melakukan apa yang akan Anda lakukan dengan benang agar tetap teratur: ia dikemas dengan rapi menjadi gulungan yang lebih kecil dan dapat diatur. Dalam kasus DNA, setiap kromosom melingkari a kompleks histon untuk membentuk urutan pertama organisasi kromosom: nukleosom.

Gambar (PageIndex<4>). Nukleosom terdiri dari sedikit lebih dari dua putaran DNA di sekitar inti histon yang mengandung dua salinan masing-masing histon H2A, H2B, H3, dan H4. Histon H1 bukan merupakan bagian dari unit inti dan berfungsi dalam koordinasi interaksi antar nukleosom.

Serat 30 nm disatukan oleh dua set interaksi. Pertama, histon penghubung, H1, menyatukan nukleosom menjadi struktur kira-kira 30 nm. Struktur ini kemudian distabilkan oleh ikatan disulfida yang terbentuk antara histon H2A dari satu nukleosom dan histon H4 tetangganya.

Histon adalah keluarga protein dasar (bermuatan positif). Mereka semua berfungsi terutama dalam mengatur DNA, dan nukleosom terbentuk ketika DNA membungkus (sedikit lebih dari 2 kali) di sekitar inti delapan histon - masing-masing dua H2A, H2B, H3, dan H4. Jumlah dan posisi muatan positif (kebanyakan dari lisin dan arginin) sangat penting untuk kemampuan mereka untuk mengikat erat DNA, yang seperti yang ditunjukkan sebelumnya, bermuatan sangat negatif. Ide &ldquoberlawanan menarik&rdquo bukan hanya tip kencan dari kolom saran.

Gambar dari RCSB Protein Data Bank (http://www.rcsb.org).

Setelah pemeriksaan struktur 3D kompleks inti histon, kita melihat bahwa sementara domain interaksi protein yang relatif tidak bermuatan menahan histon bersama-sama di tengah, residu bermuatan positif ditemukan di sekitar bagian luar kompleks, tersedia untuk berinteraksi dengan fosfat bermuatan negatif. dari DNA.

Dalam bab selanjutnya, kita akan membahas bagaimana enzim membaca DNA untuk menyalin informasinya ke bagian RNA yang lebih kecil dan lebih mudah diatur. Untuk saat ini, kita hanya perlu menyadari bahwa pada waktu tertentu, banyak DNA yang terbungkus rapat, sementara beberapa bagian DNA tidak. Karena bagian-bagian yang tersedia untuk digunakan dapat bervariasi tergantung pada apa yang terjadi pada/di dalam sel pada waktu tertentu, pengemasan DNA harus dinamis. Harus ada mekanisme untuk dengan cepat melonggarkan pengikatan DNA ke histon ketika DNA itu diperlukan untuk ekspresi gen, dan untuk mengencangkan pengikatan ketika tidak. Ternyata, proses ini melibatkan asetilasi dan deasetilasi dari histon.

Gambar (PageIndex<6>). (A) Histon terdeasetilasi memungkinkan interaksi antara fosfat DNA yang bermuatan negatif dan lisin histon yang bermuatan positif. (B) Ketika histon diasetilasi, tidak hanya muatan positif pada lisin yang hilang, gugus asetil juga memberikan muatan negatif, menolak fosfat DNA.

Histon Acetyltransferases (HATs) adalah enzim yang menempatkan gugus asetil pada lisin protein histon. Gugus asetil bermuatan negatif, dan asetilasi tidak hanya menambah gugus bermuatan negatif, tetapi juga menghilangkan muatan positif dari lisin. Ini memiliki efek tidak hanya menetralkan titik tarik-menarik antara protein dan DNA, tetapi bahkan sedikit menolaknya (dengan muatan serupa). Di sisi lain mekanisme, Histone Deactylases (HDACs) adalah enzim yang menghilangkan asetilasi, dan dengan demikian mengembalikan interaksi antara protein histon dan DNA. Karena ini adalah enzim yang sangat penting, masuk akal bahwa mereka tidak diizinkan untuk beroperasi mau tidak mau pada histon yang tersedia, dan pada kenyataannya, mereka sering ditemukan dalam kompleks dengan protein lain yang mengontrol dan mengoordinasikan aktivasi mereka dengan proses lain seperti sebagai aktivasi transkripsi.


Masing-masing Manik-manik Kaca Mikroskopis ini Menyimpan Gambar yang Dikodekan pada Untaian DNA

Semakin, informasi peradaban disimpan secara digital, dan penyimpanan itu berlimpah dan berkembang. Kami tidak repot-repot menghapus tujuh video definisi tinggi langit-langit atau 20 foto buram sudut meja yang diambil oleh anak kami. Ada banyak ruang di smartphone atau di cloud, dan kami mengandalkan keduanya meningkat setiap tahun.

Saat kami dengan lancar menyalin informasi dari perangkat ke perangkat, situasi ini tampaknya bertahan lama. Tapi itu belum tentu benar.

Jumlah data yang kami buat meningkat dengan cepat. Dan jika kita (secara apokaliptik) kehilangan kemampuan untuk memproduksi perangkat penyimpanan digital—hard drive atau pita magnetik, misalnya—catatan digital kolektif peradaban kita akan mulai menimbulkan lubang dalam beberapa tahun. Dalam beberapa dekade, itu menjadi tidak terbaca. Penyimpanan digital tidak seperti buku atau tablet batu. Ini memiliki tanggal kedaluwarsa yang lebih pendek. Dan, meskipun kami menganggap remeh penyimpanan, itu masih mahal dan haus energi.

Itulah sebabnya para peneliti mencari cara baru untuk mengarsipkan informasi. Dan DNA, “hard drive,” kehidupan, mungkin menjadi salah satu solusi. DNA menawarkan penyimpanan data yang sangat padat, dan dalam kondisi yang tepat, DNA dapat menyimpan informasi secara utuh selama ribuan tahun.

Dalam beberapa tahun terakhir, para ilmuwan telah mengembangkan penyimpanan data DNA. Mereka telah menunjukkan bagaimana kita dapat menyandikan buku, foto, dan bahkan GIF individu dalam DNA dan kemudian mengambilnya kembali. Tetapi belum ada cara yang terukur untuk mengatur dan mengambil koleksi besar file DNA. Sampai sekarang begitu.

Di baru Bahan Alam kertas, tim dari MIT dan Harvard's Broad Institute menggambarkan sistem penyimpanan berbasis DNA yang memungkinkan mereka untuk mencari dan menarik file individu—dalam hal ini gambar yang dikodekan dalam DNA. Ini sedikit seperti membolak-balik lemari arsip Anda, membaca tab kertas untuk mengidentifikasi folder, dan kemudian menarik akta ke mobil Anda darinya. Hanya saja, jelas, detailnya sedikit lebih rumit.

“Kami membutuhkan solusi baru untuk menyimpan sejumlah besar data yang dikumpulkan dunia, terutama data arsip,” kata Mark Bathe, profesor teknik biologi MIT dan penulis senior makalah ini. “DNA seribu kali lipat lebih padat daripada memori flash, dan properti lain yang menarik adalah setelah Anda membuat polimer DNA, ia tidak menghabiskan energi apa pun. Anda dapat menulis DNA dan menyimpannya selamanya.”

Bagaimana Mengatur Sistem Penyimpanan DNA

Bagaimana cara mengkodekan gambar dalam untaian DNA? Ini masalah terjemahan yang cukup sederhana.

Setiap piksel dari gambar digital dikodekan dalam bit. Bit-bit ini diwakili oleh 1s dan 0s. Untuk mengubahnya menjadi DNA, para ilmuwan menetapkan masing-masing bit ini ke empat molekul dasar DNA, atau nukleotida, adenin, sitosin, guanin, dan timin—biasanya disingkat dengan huruf A, C, G, dan T. Basa DNA A dan G, misalnya, dapat mewakili 1, dan C dan T dapat mewakili 0.

Selanjutnya, peneliti merangkai (atau mensintesis) rantai basa DNA yang mewakili setiap bit informasi dalam file asli. Untuk mengambil gambar, peneliti membalikkan proses, membaca urutan basa DNA (atau mengurutkannya) dan menerjemahkan data kembali menjadi bit.

Namun, proses pengambilan standar memiliki beberapa kelemahan.

Peneliti menggunakan teknik yang disebut polymerase chain reaction (PCR) untuk menarik file. Setiap untai DNA mencakup urutan pengidentifikasi yang cocok dengan urutan nukleotida pendek yang disebut primer PCR. Ketika primer ditambahkan ke larutan DNA, ia mengikat dengan untaian DNA yang cocok — yang ingin kita baca — dan hanya urutan itu yang diamplifikasi (yaitu, disalin untuk pengurutan). Masalah? Primer dapat berinteraksi dengan urutan yang tidak sesuai target. Lebih buruk lagi, prosesnya menggunakan enzim yang mengunyah semua DNA-nya.

“Anda seperti membakar tumpukan jerami untuk menemukan jarumnya, karena semua DNA lainnya tidak diperkuat dan pada dasarnya Anda membuangnya,” kata Bathe.

Bola kaca mikroskopis yang digambarkan di sini adalah “file DNA.” Masing-masing berisi gambar, dikodekan dalam DNA, dan dilapisi tag DNA yang menjelaskan gambar di dalamnya. Kredit Gambar: Atas perkenan para peneliti (melalui MIT News)

Untuk menyiasatinya, tim Broad Institute merangkum untaian DNA dalam manik-manik kaca mikroskopis (6-mikron). Mereka menempelkan label DNA untai tunggal pendek ke permukaan setiap manik. Seperti nama file, label menjelaskan konten manik-manik. Gambar harimau mungkin diberi label “oranye,” “kucing,” “liar.” Kucing rumahan mungkin diberi label “oranye,” “kucing,” “domestik .” Hanya dengan empat label per manik, Anda dapat memberi label unik pada 10 20 file DNA.

Tim dapat mengambil file tertentu dengan menambahkan urutan nukleotida komplementer, atau primer, sesuai dengan label file individual. Primer mengandung molekul fluoresen, dan ketika mereka terhubung dengan untai komplementer—yaitu, label yang dicari—mereka membentuk heliks ganda dan bersinar. Mesin memisahkan manik-manik bercahaya, yang dibuka dan DNA di dalamnya diurutkan. Sisa file DNA tetap tidak tersentuh, dibiarkan dalam damai untuk menjaga informasi mereka.

Bagian terbaik dari metode ini adalah skalabilitasnya. Secara teori, Anda dapat memiliki perpustakaan DNA besar yang disimpan dalam tabung reaksi—Catatan Mandi, secangkir kopi DNA dapat menyimpan semua data dunia—tetapi tanpa cara mudah untuk mencari dan mengambil file persis yang Anda cari , itu tidak berharga. Dengan metode ini, semuanya bisa diambil.

George Church, seorang profesor genetika Harvard dan tokoh terkenal di bidang biologi sintetik, menyebutnya sebagai “lompatan raksasa” untuk bidang ini.

“Kemajuan yang cepat dalam menulis, menyalin, membaca, dan penyimpanan data arsip berenergi rendah dalam bentuk DNA telah meninggalkan peluang yang kurang dieksplorasi untuk pengambilan file data yang tepat dari database…besar”,” katanya. “Studi baru secara spektakuler membahas hal ini menggunakan lapisan luar DNA yang sepenuhnya independen dan memanfaatkan sifat DNA yang berbeda (hibridisasi daripada pengurutan), dan terlebih lagi, menggunakan instrumen dan kimia yang ada.”

Ini Tidak Datang Untuk Komputer Anda

Agar jelas, semua penyimpanan data DNA, termasuk pekerjaan yang digariskan dalam penelitian ini, tetap kokoh dalam tahap penelitian. Jangan berharap hard drive DNA untuk laptop Anda dalam waktu dekat.

Sintesis DNA masih sangat mahal. Butuh biaya sekitar $1 triliun dolar untuk menulis satu petabyte data dalam DNA. Untuk mencocokkan pita magnetik, metode umum penyimpanan data arsip, Bathe memperkirakan biaya sintesis harus turun enam kali lipat. Juga, ini bukan teknik tercepat (secara halus).

Biaya sintesis DNA akan turun—teknologi juga maju di bidang lain—dan dengan lebih banyak pekerjaan, kecepatannya akan meningkat. Tapi yang terakhir mungkin tidak penting. Artinya, jika kita terutama peduli dengan mencadangkan data penting untuk jangka panjang dengan kebutuhan energi minimal dan tidak perlu mengaksesnya secara teratur, maka kecepatan kurang penting daripada kesetiaan, kepadatan data, dan daya tahan.

DNA sudah menyimpan informasi dunia hidup, sekarang, tampaknya, dapat melakukan hal yang sama untuk semua hal digital juga.


Implikasi Medis dari Peta Genom Manusia Terperinci

Kemajuan dalam genetika molekuler yang dibuat selama dua dekade terakhir telah berdampak besar pada penelitian medis dan perawatan klinis. Kemampuan untuk mengkloning dan menganalisis gen individu dan untuk menyimpulkan urutan asam amino dari protein yang dikodekan telah sangat meningkatkan pemahaman kita tentang kelainan genetik, sistem kekebalan, kelainan endokrin, penyakit arteri koroner, penyakit menular, dan kanker. Beberapa protein yang diproduksi dalam skala komersial dengan metode DNA rekombinan tersedia untuk penggunaan terapeutik atau dalam uji klinis, dan banyak lagi yang masih dalam tahap perkembangan awal. Kemajuan terbaru dalam menentukan dasar genetik untuk gangguan neurologis dan perilaku seperti penyakit Huntington (Gusella dkk., 1983), penyakit Alzheimer (St George-Hyslop dkk., 1987), dan penyakit manik-depresif (Egeland dkk., 1987) menjanjikan wawasan baru ke dalam kondisi umum dan serius ini. Peta genom manusia beresolusi lebih tinggi akan mempercepat kemajuan dalam memahami patogenesis penyakit dan dalam mengembangkan pendekatan baru untuk diagnosis, pengobatan, dan pencegahan di banyak bidang kedokteran. Dalam Bab 3, dampak medis potensial dari peta genomik manusia yang terperinci dibahas lebih lanjut.


Replikasi DNA

  • Dua untai asli DNA dipisahkan dengan bantuan enzim yang dikenal sebagai: DNA helikase . Helikase bekerja dengan memutus ikatan hidrogen yang menahan basa nukleotida bersama-sama.
  • Enzim yang dikenal sebagai DNA polimerase menambahkan nukleotida komplementer ke setiap untai. Ikatan adenin dengan timin, dan ikatan sitosin dengan guanin.
  • Dua molekul DNA, yang identik dengan molekul DNA asli, terbentuk. Setiap molekul DNA yang baru terbentuk terdiri dari dua untai DNA, satu dari molekul induk dan satu lagi dibangun dari awal menggunakan molekul induk sebagai cetakan.

Replikasi DNA dikatakan semi konservatif . Setiap salinan berisi satu untai yang baru direplikasi dan satu untai dari molekul asli.

Proses replikasi DNA secara biologis penting karena memungkinkan sel-sel organisme hidup untuk menyalin DNA mereka sebelum pembelahan sel.


Mengenai nukleotida yang berbeda pada untai DNA - Biologi

Adenin dan guanin adalah purin. Purin adalah yang lebih besar dari dua jenis basa yang ditemukan dalam DNA. 9 atom yang membentuk cincin yang menyatu (5 karbon, 4 nitrogen) diberi nomor 1-9. Semua atom cincin terletak pada bidang yang sama. Sitosin dan timin adalah pirimidin. 6 atom (4 karbon, 2 nitrogen) diberi nomor 1-6. Seperti purin, semua atom cincin pirimidin terletak pada bidang yang sama.

Gula Deoksiribosa

Gula deoksiribosa dari tulang punggung DNA memiliki 5 karbon dan 3 oksigen. Atom karbon diberi nomor 1', 2', 3', 4', dan 5' untuk membedakan dari penomoran atom cincin purin dan pirimidin. Gugus hidroksil pada karbon 5'- dan 3'- berikatan dengan gugus fosfat untuk membentuk tulang punggung DNA. Deoksiribosa tidak memiliki gugus hidroksil pada posisi 2' bila dibandingkan dengan ribosa, komponen gula RNA.

Nukleosida dan Nukleotida

Nukleosida adalah salah satu dari empat basa DNA yang terikat secara kovalen pada posisi C1 gula. Gula dalam deoksinukleosida adalah 2'-deoksiribosa. Gula dalam ribonukleosida adalah ribosa. Nukleosida berbeda dari nukleotida karena tidak memiliki gugus fosfat. Empat nukleosida DNA yang berbeda adalah deoxyadenosine (dA), deoxyguanosine (dG), deoxycytosine (dC), dan (deoxy)thymidine (dT, atau T). Dalam dA dan dG, ada ikatan "N-glikosida" antara gula C1' dan N9 dari purin. Nukleotida adalah nukleosida dengan satu atau lebih gugus fosfat yang terikat secara kovalen pada gugus 3'- dan/atau 5'-hidroksil.

Tulang punggung DNA

Tulang punggung DNA adalah polimer dengan urutan gula-fosfat bergantian. Gula deoksiribosa bergabung pada gugus 3'-hidroksil dan 5'-hidroksil menjadi gugus fosfat dalam ikatan ester, juga dikenal sebagai ikatan "fosfodiester".

DNA Heliks Ganda

DNA adalah makromolekul yang biasanya beruntai ganda. Dua rantai polinukleotida, disatukan oleh gaya termodinamika yang lemah, membentuk molekul DNA.

Fitur dari Heliks Ganda DNA

  • Dua untai DNA membentuk spiral heliks, berkelok-kelok di sekitar sumbu heliks dalam spiral tangan kanan.
  • Kedua rantai polinukleotida berjalan dalam arah yang berlawanan.
  • Tulang punggung gula-fosfat dari dua untai DNA berputar di sekitar sumbu heliks seperti pagar tangga sprial.
  • Basis nukleotida individu berada di bagian dalam heliks, ditumpuk di atas satu sama lain seperti anak tangga spiral.

Pasangan Dasar

Dalam heliks ganda DNA, A membentuk 2 ikatan hidrogen dengan T pada untai yang berlawanan, dan G membentuk 3 ikatan hidrogen dengan C pada untai yang berlawanan. Pasangan basa dA-dT dan dG-dC memiliki panjang yang sama, dan menempati ruang yang sama dalam heliks ganda DNA. Oleh karena itu molekul DNA memiliki diameter yang seragam. Pasangan basa dA-dT dan dG-dC dapat terjadi dalam urutan apa pun dalam molekul DNA

Sumbu Heliks DNA

Sumbu heliks paling jelas terlihat dari pandangan langsung ke bawah sumbu. Tulang punggung gula-fosfat berada di luar heliks di mana gugus fosfat polar (atom merah dan kuning) dapat berinteraksi dengan lingkungan kutub. Nitrogen (atom biru) yang mengandung basa berada di dalam, bertumpuk tegak lurus terhadap sumbu heliks.


Mengapa sekuensing DNA berguna?

Pengurutan DNA adalah teknik biologis yang diandalkan oleh banyak teknologi berbeda. Misalnya, dapat digunakan untuk:

  • mengidentifikasi daerah DNA yang terkait dengan fitur tertentu, termasuk penyakit tertentu atau peningkatan kerentanan terhadap penyakit tertentu
  • memahami ekspresi gen dan bagaimana gen yang berbeda berinteraksi
  • identifikasi zat, individu dan spesies
  • teknologi genetik lainnya seperti terapi gen, penelitian silsilah, pemuliaan tanaman dan hewan serta modifikasi genetik.

Pertanyaan : 1. Manakah dari pernyataan berikut tentang DNA yang SALAH? satu molekul DNA dapat mencakup empat nukleotida berbeda dalam strukturnya, DNA adalah heliks ganda, DNA menggunakan basa nitrogen urasil, DNA memiliki deoksiribosa 2. Manakah dari pernyataan berikut mengenai heliks ganda DNA yang SELALU benar? jumlah adenin selalu sama dengan jumlah urasil dan

1. Manakah dari pernyataan berikut tentang DNA yang SALAH? satu molekul DNA dapat mencakup empat nukleotida berbeda dalam strukturnya, DNA adalah heliks ganda, DNA menggunakan basa nitrogen urasil, DNA memiliki deoksiribosa

2. Manakah dari pernyataan berikut tentang heliks ganda DNA yang SELALU benar? jumlah adenin selalu sama dengan jumlah urasil dan jumlah guanin selalu sama dengan jumlah sitosin, jumlah adenin selalu sama dengan jumlah guanin dan jumlah sitosin selalu sama dengan jumlah timin, jumlah adenin selalu sama dengan jumlah timin dan jumlah guanin selalu sama dengan jumlah sitosin, jumlah adenin selalu sama dengan jumlah sitosin dan jumlah guanin selalu sama dengan jumlah timin.

3. Manakah dari pernyataan berikut tentang RNA yang SALAH? RNA datang dalam 3 bentuk, RNA memiliki basa nukleotida urasil, RNA adalah molekul beruntai tunggal, RNA memiliki gula dekstrosa

4. Jika pada untai DNA adalah CGGTAC maka untai komplementernya adalah L GCCAUG, CGGTAC, CGGUAC, GCCATG

5. Manakah dari enzim berikut yang mengkatalisis pemanjangan untai baru DNA? protein pengikat untai tunggal, ligase, helikase, DNA polimerase.


Biologi 171


Sejak penemuan kembali karya Mendel pada tahun 1900, definisi gen telah berkembang dari unit abstrak hereditas menjadi entitas molekul nyata yang mampu bereplikasi, berekspresi, dan bermutasi ((Gambar)). Gen terdiri dari DNA dan tersusun secara linier pada kromosom. Gen menentukan urutan asam amino, yang merupakan blok bangunan protein. Pada gilirannya, protein bertanggung jawab untuk mengatur hampir setiap fungsi sel. Baik gen maupun protein yang mereka kodekan sangat penting bagi kehidupan seperti yang kita ketahui.

Tujuan pembelajaran

Pada akhir bagian ini, Anda akan dapat melakukan hal berikut:

  • Jelaskan “dogma sentral” dari sintesis DNA-protein
  • Jelaskan kode genetik dan bagaimana urutan nukleotida menentukan asam amino dan urutan protein

Proses transkripsi seluler menghasilkan messenger RNA (mRNA), salinan molekuler seluler dari satu atau lebih gen dengan alfabet A, C, G, dan urasil (U). Penerjemahan template mRNA pada ribosom mengubah informasi genetik berbasis nukleotida menjadi produk protein. Itulah dogma sentral dari sintesis DNA-protein. Urutan protein terdiri dari 20 asam amino yang umum terjadi oleh karena itu, dapat dikatakan bahwa alfabet protein terdiri dari 20 "huruf" ((Gambar)). Asam amino yang berbeda memiliki kimia yang berbeda (seperti asam versus basa, atau polar dan nonpolar) dan kendala struktural yang berbeda. Variasi dalam urutan asam amino bertanggung jawab atas variasi yang sangat besar dalam struktur dan fungsi protein.

Struktur dari 20 asam amino yang ditemukan dalam protein ditunjukkan. Setiap asam amino terdiri dari gugus amino (), gugus karboksil (COO – ), dan rantai samping (biru). Rantai samping mungkin nonpolar, polar, atau bermuatan, serta besar atau kecil. Variasi rantai samping asam amino inilah yang menimbulkan variasi struktur dan fungsi protein yang luar biasa.

Dogma Sentral: DNA Mengkode RNA RNA Mengkode Protein

The flow of genetic information in cells from DNA to mRNA to protein is described by the central dogma ((Figure)), which states that genes specify the sequence of mRNAs, which in turn specify the sequence of amino acids making up all proteins. Penguraian satu molekul ke molekul lain dilakukan oleh protein dan RNA tertentu. Karena informasi yang disimpan dalam DNA sangat penting bagi fungsi seluler, masuk akal secara intuitif bahwa sel akan membuat salinan mRNA dari informasi ini untuk sintesis protein, sambil menjaga DNA itu sendiri tetap utuh dan terlindungi. Penyalinan DNA ke RNA relatif mudah, dengan satu nukleotida ditambahkan ke untai mRNA untuk setiap nukleotida yang dibaca dalam untai DNA. Translasi ke protein sedikit lebih kompleks karena tiga nukleotida mRNA sesuai dengan satu asam amino dalam urutan polipeptida. Namun, translasi ke protein masih sistematis dan kolinear, sehingga nukleotida 1 hingga 3 sesuai dengan asam amino 1, nukleotida 4 hingga 6 sesuai dengan asam amino 2, dan seterusnya.

Kode Genetik Degenerasi dan Universal

Setiap asam amino didefinisikan oleh urutan tiga nukleotida yang disebut kodon triplet. Given the different numbers of “letters” in the mRNA and protein “alphabets,” scientists theorized that single amino acids must be represented by combinations of nucleotides. Penggandaan nukleotida tidak akan cukup untuk menentukan setiap asam amino karena hanya ada 16 kemungkinan kombinasi dua nukleotida (4 2 ). Sebaliknya, ada 64 kemungkinan kembar tiga nukleotida (4 3 ), yang jauh lebih banyak daripada jumlah asam amino. Scientists theorized that amino acids were encoded by nucleotide triplets and that the genetic code was “degenerate.” Dengan kata lain, asam amino tertentu dapat dikodekan oleh lebih dari satu triplet nukleotida. This was later confirmed experimentally: Francis Crick and Sydney Brenner used the chemical mutagen proflavin to insert one, two, or three nucleotides into the gene of a virus. When one or two nucleotides were inserted, the normal proteins were not produced. Ketika tiga nukleotida dimasukkan, protein disintesis dan berfungsi. This demonstrated that the amino acids must be specified by groups of three nucleotides. Triplet nukleotida ini disebut kodon. The insertion of one or two nucleotides completely changed the triplet reading frame , thereby altering the message for every subsequent amino acid ((Figure)). Meskipun penyisipan tiga nukleotida menyebabkan asam amino tambahan disisipkan selama translasi, integritas protein lainnya tetap dipertahankan.

Scientists painstakingly solved the genetic code by translating synthetic mRNAs in vitro and sequencing the proteins they specified ((Figure)).

In addition to codons that instruct the addition of a specific amino acid to a polypeptide chain, three of the 64 codons terminate protein synthesis and release the polypeptide from the translation machinery. These triplets are called nonsense codons , or stop codons. Kodon lain, AUG, juga memiliki fungsi khusus. Selain menentukan asam amino metionin, ini juga berfungsi sebagai kodon awal untuk memulai translasi. The reading frame for translation is set by the AUG start codon near the 5′ end of the mRNA. Following the start codon, the mRNA is read in groups of three until a stop codon is encountered.

The arrangement of the coding table reveals the structure of the code. There are sixteen “blocks” of codons, each specified by the first and second nucleotides of the codons within the block, e.g., the “AC*” block that corresponds to the amino acid threonine (Thr). Some blocks are divided into a pyrimidine half, in which the codon ends with U or C, and a purine half, in which the codon ends with A or G. Some amino acids get a whole block of four codons, like alanine (Ala), threonine (Thr) and proline (Pro). Some get the pyrimidine half of their block, like histidine (His) and asparagine (Asn). Others get the purine half of their block, like glutamate (Glu) and lysine (Lys). Note that some amino acids get a block and a half-block for a total of six codons.

The specification of a single amino acid by multiple similar codons is called “degeneracy.” Degeneracy is believed to be a cellular mechanism to reduce the negative impact of random mutations. Kodon yang menentukan asam amino yang sama biasanya hanya berbeda satu nukleotida. Selain itu, asam amino dengan rantai samping yang mirip secara kimiawi dikodekan oleh kodon yang serupa. For example, aspartate (Asp) and glutamate (Glu), which occupy the GA* block, are both negatively charged. This nuance of the genetic code ensures that a single-nucleotide substitution mutation might specify the same amino acid but have no effect or specify a similar amino acid, preventing the protein from being rendered completely nonfunctional.

The genetic code is nearly universal. With a few minor exceptions, virtually all species use the same genetic code for protein synthesis. Konservasi kodon berarti bahwa mRNA murni yang mengkode protein globin pada kuda dapat ditransfer ke sel tulip, dan tulip akan mensintesis globin kuda. Bahwa hanya ada satu kode genetik adalah bukti kuat bahwa semua kehidupan di Bumi memiliki asal usul yang sama, terutama mengingat ada sekitar 10 84 kemungkinan kombinasi dari 20 asam amino dan 64 kodon triplet.

View Transcribe and Translate a Gene (webpage, Flash animation) to transcribe a gene and translate it to protein using complementary pairing and the genetic code.

Mana yang Memiliki Lebih Banyak DNA: Kiwi atau Stroberi?

Pertanyaan: Would a kiwi and strawberry that are approximately the same size ((Figure)) also have approximately the same amount of DNA?

Latar belakang: Gen dibawa pada kromosom dan terbuat dari DNA. Semua mamalia adalah diploid, artinya mereka memiliki dua salinan dari setiap kromosom. Namun, tidak semua tanaman diploid. Stroberi yang umum adalah octoploid (8n) dan kiwi yang dibudidayakan adalah hexaploid (6n). Teliti jumlah total kromosom dalam sel masing-masing buah ini dan pikirkan bagaimana ini mungkin sesuai dengan jumlah DNA dalam inti sel buah-buahan ini. What other factors might contribute to the total amount of DNA in a single fruit? Baca tentang teknik isolasi DNA untuk memahami bagaimana setiap langkah dalam protokol isolasi membantu membebaskan dan mengendapkan DNA.

Hipotesa: Berhipotesis apakah Anda dapat mendeteksi perbedaan kuantitas DNA dari stroberi dan kiwi yang berukuran sama. Buah mana yang menurut Anda akan menghasilkan lebih banyak DNA?

Uji hipotesis Anda: Pisahkan DNA dari stroberi dan kiwi yang berukuran sama. Perform the experiment in at least triplicate for each fruit

  1. Siapkan sebotol buffer ekstraksi DNA dari 900 mL air, 50 mL deterjen piring, dan dua sendok teh garam meja. Campur dengan inversi (tutup dan putar terbalik beberapa kali).
  2. Grind a strawberry and a kiwi by hand in a plastic bag, or using a mortar and pestle, or with a metal bowl and the end of a blunt instrument. Giling setidaknya dua menit per buah.
  3. Tambahkan 10 mL buffer ekstraksi DNA ke setiap buah, dan aduk rata setidaknya selama satu menit.
  4. Hapus puing-puing seluler dengan menyaring setiap campuran buah melalui kain tipis atau kain berpori dan ke dalam corong yang ditempatkan dalam tabung reaksi atau wadah yang sesuai.
  5. Tuang etanol dingin atau isopropanol (alkohol gosok) ke dalam tabung reaksi. Anda harus mengamati DNA putih yang diendapkan.
  6. Kumpulkan DNA dari setiap buah dengan melilitkannya di sekitar batang kaca yang terpisah.

Catat pengamatan Anda: Karena Anda tidak mengukur volume DNA secara kuantitatif, Anda dapat merekam untuk setiap percobaan apakah kedua buah menghasilkan jumlah DNA yang sama atau berbeda seperti yang diamati oleh mata. Jika satu atau buah lainnya menghasilkan lebih banyak DNA, catat juga. Tentukan apakah pengamatan Anda konsisten dengan beberapa potong setiap buah.

Analisis data Anda: Apakah Anda melihat perbedaan yang jelas dalam jumlah DNA yang dihasilkan oleh setiap buah? Apakah hasil Anda dapat direproduksi?

Menarik kesimpulan: Berdasarkan apa yang Anda ketahui tentang jumlah kromosom pada setiap buah, dapatkah Anda menyimpulkan bahwa jumlah kromosom tentu berkorelasi dengan jumlah DNA? Dapatkah Anda mengidentifikasi kelemahan dari prosedur ini? Jika Anda memiliki akses ke laboratorium, bagaimana Anda bisa membakukan perbandingan Anda dan membuatnya lebih kuantitatif?

Ringkasan Bagian

Kode genetik mengacu pada alfabet DNA (A, T, C, G), alfabet RNA (A, U, C, G), dan alfabet polipeptida (20 asam amino). The central dogma describes the flow of genetic information in the cell from genes to mRNA to proteins. Genes are used to make mRNA by the process of transcription mRNA is used to synthesize proteins by the process of translation. The genetic code is degenerate because 64 triplet codons in mRNA specify only 20 amino acids and three nonsense codons. Most amino acids have several similar codons. Almost every species on the planet uses the same genetic code.

Respons Gratis

Bayangkan jika ada 200 asam amino yang umum terjadi, bukan 20. Mengingat apa yang Anda ketahui tentang kode genetik, berapa panjang kodon terpendek yang mungkin? Menjelaskan.

For 200 commonly occurring amino acids, codons consisting of four types of nucleotides would have to be at least four nucleotides long, because 4 4 = 256. There would be much less degeneracy in this case.

Diskusikan bagaimana degenerasi kode genetik membuat sel lebih kuat terhadap mutasi.

Kodon yang menentukan asam amino yang sama biasanya hanya berbeda satu nukleotida. Selain itu, asam amino dengan rantai samping yang mirip secara kimiawi dikodekan oleh kodon yang serupa. This nuance of the genetic code ensures that a single-nucleotide substitution mutation might either specify the same amino acid and have no effect, or may specify a similar amino acid, preventing the protein from being rendered completely nonfunctional.

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain this mRNA makes when it is translated?

The first step to writing the amino acid sequence is to find the start codon AUG. Then, the nucleotide sequence is separated into triplets: CU AUG UGU CGU AAC AGC CGA UGA. We stop the translation at UGA because that triplet encodes a stop codon. When we convert these codons to amino acids, the sequence becomes Met Cys Arg Asn Ser Arg.

Glosarium


Isi

DNA encodes protein sequence by a series of three-nucleotide codons. Any given sequence of DNA can therefore be read in six different ways: Three reading frames in one direction (starting at different nucleotides) and three in the opposite direction. During transcription, the RNA polymerase read the template DNA strand in the 3′→5′ direction, but the mRNA is formed in the 5′ to 3′ direction. [3] The mRNA is single-stranded and therefore only contains three possible reading frames, of which only one is translated. The codons of the mRNA reading frame are translated in the 5′→3′ direction into amino acids by a ribosome to produce a polypeptide chain.

An open reading frame (ORF) is a reading frame that has the potential to be transcribed into RNA and translated into protein. It requires a continuous sequence of DNA from a start codon, through a subsequent region which usually has a length that is a multiple of 3 nucleotides, to a stop codon in the same reading frame. [4]

When a putative amino acid sequence resulting from the translation of an ORF remained unknown in mitochondrial and chloroplast genomes, the corresponding open reading frame was called an unidentified reading frame (URF). For example, the MT-ATP8 gene was first described as URF A6L when the complete human mitochondrial genome was sequenced. [5]

The usage of multiple reading frames leads to the possibility of overlapping genes there may be many of these in viral, prokaryote, and mitochondrial genomes. [6] Some viruses, e.g. hepatitis B virus and BYDV, use several overlapping genes in different reading frames.

In rare cases, a ribosome may shift from one frame to another during translation of an mRNA (translational frameshift). This causes the first part of the mRNA to be translated in one reading frame, and the latter part to be translated in a different reading frame. This is distinct from a frameshift mutation, as the nucleotide sequence (DNA or RNA) is not altered—only the frame in which it is read.


Tonton videonya: ՆՈՒԿԼԵԻՆԱԹԹՈՒՆԵՐ ՄԱՍ 2. ԴՆԹ-ի հատկությունները (Agustus 2022).