Informasi

Mengapa kami menggunakan metode pengurutan DNA seperti shotgun?

Mengapa kami menggunakan metode pengurutan DNA seperti shotgun?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Saya belajar tentang kloning DNA untuk pertama kalinya. Yang saya pahami adalah, untuk mengkloning DNA, kami memecah gen asli menjadi beberapa bagian. Kemudian cobalah untuk menyatukannya kembali.

Mengapa tepatnya kita melakukan ini? Alih-alih, bukankah lebih baik mengkloning satu basis pada satu waktu? Pada dasarnya dalam kode semu:

old_dna_strand = 'ACTCATGCGAGCGTCAGTAGTACGTACTG' new_dna = "" untuk basis di old_dna_strand: new_dna+=base

Itu terlihat jauh lebih mudah dan jauh lebih sedikit rentan terhadap kesalahan. Mengapa kita memiliki metode aneh seperti senapan?

Terima kasih sebelumnya. Beri tahu saya jika saya harus mengklarifikasi atau memperbarui apa pun dalam pertanyaan ini.


Ini adalah teknik dari "masa lalu" sekuensing genom. Metode yang mendasari pengurutan adalah metode pemutusan rantai Sanger yang dapat membaca panjang antara 100 dan 1000 pasangan basa (tergantung pada instrumen yang digunakan). Ini berarti Anda harus memecah molekul DNA yang lebih panjang, mengkloning dan kemudian mengurutkannya. Ada dua metode yang mungkin.

Yang pertama disebut kromosom (atau primer) berjalan dan dimulai dengan mengurutkan potongan pertama. Potongan DNA berikutnya (yang kemudian menggunakan primer spesifik dari akhir urutan. Potongan berikutnya (bersebelahan) dari urutan kemudian diurutkan menggunakan primer yang melengkapi akhir urutan pertama dibaca dan seterusnya Teknik ini tidak membutuhkan banyak perakitan, tetapi Anda membutuhkan banyak primer dan relatif lambat.

Untuk mengatasi masalah ini metode shotgun sequencing dikembangkan. Di sini DNA dipecah menjadi bagian-bagian yang berbeda (tidak semua dipecah di tempat yang sama), dikloning dan diurutkan dengan primer khusus untuk vektor yang digunakan untuk kloning. Ujung-ujungnya menjadi urutan yang tumpang tindih yang kemudian harus dirakit menjadi satu urutan di komputer. Metode ini memungkinkan paralelisasi sekuensing (Anda dapat menyiapkan banyak reaksi sekuensing pada saat yang sama dan menjalankannya) yang membuat proses lebih cepat dan juga menghindari kebutuhan primer spesifik sekuens. Masalahnya adalah mengurutkan urutan berulang, karena tumpang tindih tidak begitu jelas di sini. Untuk mengatasi masalah ini, draf pertama dibuat dan kemudian daerah kritis diurutkan kembali menggunakan teknik lain sebagai jalan primer. Lihat halaman Wikipedia tentang urutan senapan jika Anda ingin membaca lebih detail.


Analisis Urutan

Pengantar Analisis Urutan

Analisis urutan adalah istilah yang secara komprehensif mewakili analisis komputasi dari urutan DNA, RNA atau peptida, untuk mengekstrak pengetahuan tentang sifat, fungsi biologis, struktur dan evolusinya. Untuk melakukan analisis urutan secara efisien, penting untuk terlebih dahulu memahami sumber data, yaitu, metode eksperimen yang berbeda yang digunakan untuk menentukan urutan biologis. Kami kemudian perlu mengikuti strategi analitik, tergantung pada apakah urutannya genomik, transkriptomik, atau proteomik. Basis data yang saat ini menyimpan data besar pada biomolekul ini perlu diperiksa terlebih dahulu untuk keberadaan urutan serupa, yang mungkin mengarahkan pengujian eksperimental untuk penyelidikan fungsional. Perangkat lunak dan layanan web sering digunakan untuk melakukan analisis bioinformatika. Setelah analisis urutan DNA, RNA dan protein, penting untuk memahami bagaimana mereka terhubung oleh protein ke pemetaan genom. Molekul organik kecil atau metabolit yang penting bagi organisme untuk hidup dan tumbuh juga perlu dipelajari dalam konteks interaksinya dengan gen dan protein, melalui jalur metabolisme. Artikel ini bertujuan untuk memberikan gambaran tentang analisis urutan, pada tingkat DNA, RNA dan protein, dengan jalur metabolisme yang menggambarkan interaksi mereka.


Metode Pengurutan Mikroba

Dapatkan wawasan genetik kritis tentang bakteri dan virus dengan sekuensing mikroba. Baik Anda sedang melakukan studi metagenomik, atau memantau wabah penyakit, basis luas metode pengurutan generasi berikutnya (NGS) mikroba kami akan membantu Anda menemukan jawaban, lebih cepat dan lebih efisien daripada yang pernah Anda bayangkan.

Reagen dan perangkat lunak yang mudah digunakan memungkinkan Anda bergerak dengan mulus melalui alur kerja pengurutan, dari persiapan sampel hingga interpretasi data secara biologis. Pelajari lebih lanjut tentang berbagai metode pengurutan mikroba di bawah ini.

Jelajahi Metode Pengurutan Mikroba

Urutan rRNA 16S dan ITS

Pengurutan 16S dan Internal Transcribed Spacer (ITS) ribosomal RNA (rRNA) adalah metode pengurutan amplikon yang umum digunakan untuk mengidentifikasi dan membandingkan bakteri atau jamur yang ada dalam sampel tertentu, dan dapat mengidentifikasi galur yang mungkin tidak ditemukan menggunakan metode tradisional.

Metagenomics Senapan

Dengan kemampuan untuk menggabungkan banyak sampel sekuensing mikroba dalam sekali proses dan mendapatkan cakupan sekuens tinggi per sampel, sekuensing metagenomik shotgun dapat mendeteksi anggota komunitas mikroba dengan kelimpahan sangat rendah yang mungkin terlewatkan dengan metode lain.

Analisis Transkriptom Mikroba

Tidak seperti metode berbasis hibridisasi seperti microarrays, sekuensing RNA mikroba memungkinkan identifikasi spesifik untai yang tidak bias dari transkrip umum dan baru.

Sekuensing Mikroba Seluruh Genom

Sequencing seluruh genom (WGS) berbasis NGS memungkinkan peneliti mikrobiologi untuk mengurutkan ratusan organisme dengan kekuatan multiplexing. Tidak seperti metode tradisional, tidak diperlukan langkah kloning padat karya.

Kisah Penelitian Sekuensing Mikroba Terbaru

Novogene China adalah Kekuatan Global

Penyedia layanan NGS telah menyelesaikan 1,2 juta sampel—dan mereka baru saja memulai

Saatnya Sekarang untuk Studi Mikrobioma

Pengurutan dan transkriptomik shotgun seluruh genom memberi para peneliti dan perusahaan farmasi data untuk menyempurnakan penemuan dan pengembangan obat.

Tes COVIDSeq Berekspansi ke Lebih Banyak Pelanggan

Amandemen FDA kedua memanfaatkan kekuatan sequencer Illumina tambahan untuk pengujian COVID-19

Panduan Metode

Akses informasi yang Anda butuhkan—dari BeadChips hingga persiapan perpustakaan untuk studi genom, transkriptom, atau epigenom hingga pemilihan, analisis, dan dukungan pengurutan—semuanya di satu tempat. Pilih alat terbaik untuk lab Anda dengan panduan komprehensif kami yang dirancang khusus untuk aplikasi penelitian.

Produk Genomik Mikroba

Akses daftar lengkap produk untuk mengurutkan seluruh genom mikroba, mRNA, sampel lingkungan, wilayah yang ditargetkan, wilayah yang dipilih khusus, wilayah pengikatan protein, dan banyak lagi.

Urutan Virus Ebola

Pengurutan Illumina memungkinkan peneliti mikroba untuk melacak wabah Ebola dan memahami dampak dari tingkat mutasi virus yang cepat.

Kiat Tambahan

Temukan Lebih Banyak Konten Khusus Mikrobiologi

Fitur " Tautan Rekomendasi" yang mudah digunakan memungkinkan Anda menemukan konten dan produk yang relevan dengan genomik mikroba dan/atau bidang minat spesifik lainnya dengan mudah. Anda dapat mengakses opsi ini dari bagian atas halaman illumina.com mana pun.

Jelajahi Sumber Daya & Alat untuk Pengguna Baru

Kami menawarkan pelatihan dan yang lainnya untuk alur kerja Anda, dari awal hingga akhir. Dari mempelajari teknologi kami hingga memahami data Anda, membeli apa yang Anda butuhkan, dan mendapatkan dukungan, kami akan menyiapkan Anda untuk sukses.

Tertarik untuk menerima buletin, studi kasus, dan informasi tentang genomik mikroba? Masukkan alamat email Anda.

Sumber Daya Unggulan

Urutan Mikroba Berbasis NGS

Lihat pengantar pengurutan generasi berikutnya (NGS) dan aplikasinya untuk mikrobiologi.

Ulasan Penelitian Urutan Viral

Baca sorotan dari publikasi terbaru yang menunjukkan penggunaan teknologi pengurutan Illumina dalam virologi.

Brosur Ikhtisar Genomik Mikroba

Memberdayakan genomik mikroba dengan alat bionformatika yang kuat.

Alur Kerja NGS untuk Mikrobiologi

Cari tahu tentang solusi alur kerja pengurutan komprehensif untuk profil populasi mikroba, evolusi dan fungsinya.

Alur Kerja NGS untuk Mikrobiologi

Teknologi inovatif

Di Illumina, tujuan kami adalah menerapkan teknologi inovatif pada analisis variasi dan fungsi genetik, sehingga memungkinkan studi yang bahkan tidak terbayangkan beberapa tahun lalu. Ini adalah misi penting bagi kami untuk memberikan solusi yang inovatif, fleksibel, dan terukur untuk memenuhi kebutuhan pelanggan kami. Sebagai perusahaan global yang menempatkan nilai tinggi pada interaksi kolaboratif, penyampaian solusi yang cepat, dan memberikan tingkat kualitas tertinggi, kami berusaha keras untuk memenuhi tantangan ini. Teknologi sekuensing dan susunan inovatif Illumina memicu kemajuan terobosan dalam penelitian ilmu hayati, genomik translasi dan konsumen, dan diagnostik molekuler.

Untuk Penggunaan Penelitian Saja. Tidak untuk digunakan dalam prosedur diagnostik (kecuali disebutkan secara khusus).


Urutan generasi berikutnya: shotgun vs. amplicon

Teknik pengurutan mana yang lebih disukai untuk analisis sampel lapangan?

Tim peneliti mengumpulkan sampel di Brasil.

Gambar milik Michael Tessler.

Sequencing generasi berikutnya (NGS) dapat mengidentifikasi jenis organisme yang ada di lokasi tertentu menggunakan DNA lingkungan (eDNA). Potensi data semacam itu dalam ilmu lingkungan dan kesehatan masyarakat sangat besar. Misalnya, para peneliti telah mengamati variasi geografis dalam komposisi mikrobioma usus manusia dengan mengurutkan isolat mikroba dari sampel air limbah.

Untuk memajukan upaya ini, Michael Tessler dari Museum Sejarah Alam Amerika dan rekan-rekannya memutuskan untuk menentukan metode pengurutan generasi berikutnya yang paling efektif untuk analisis eDNA. Setelah mengumpulkan serangkaian sampel dari empat dataran banjir sungai Brasil, mereka membandingkan pengurutan senapan (pengurutan acak seluruh genom) dengan pengurutan amplikon dari gen RNA ribosom 16S pada platform Illumina dan Roche 454, masing-masing.

“Perbandingannya relatif mudah,” kata Tessler. “Pengurutan DNA menggunakan protokol dan alat standar untuk amplikon dan senapan. Setelah kami memiliki urutan, kami memilih dua pengklasifikasi taksonomi yang umum digunakan, tetapi ada banyak basis data dan pengklasifikasi yang dapat digunakan untuk jenis studi ini.”

Tim membandingkan 49 sampel untuk keragaman filum dan famili bakteri dan menemukan bahwa sekuensing amplikon mengidentifikasi hampir dua kali lebih banyak filum, termasuk empat yang tidak terwakili dalam database sekuens seluruh genom NIH. Pengurutan amplikon juga mengidentifikasi lebih banyak keluarga bakteri bila dibandingkan dengan pengurutan senapan. Secara ekologis, data urutan amplikon berhubungan lebih dekat dengan kekayaan taksonomi, kelimpahan, dan komposisi komunitas untuk masing-masing dari empat dataran banjir daripada data senapan.

Tessler percaya bahwa alasan perbedaan ini, sebagian, adalah karena urutan RNA 16S lebih terwakili dalam database. “Sekuensing amplikon yang ditargetkan 16S relatif mapan dan bergantung pada database yang luas. Urutan shotgun menghasilkan banyak fragmen genom acak, tetapi database genom besar diperlukan untuk mengidentifikasi urutan tersebut. Sejumlah filum tidak memiliki perwakilan dengan genom yang diurutkan, ”katanya.


Bantuan tugas pengurutan DNA

Sekuensing DNA adalah metode di mana urutan nukleotida ditentukan dalam molekul DNA. Oleh karena itu untuk metode ini berbagai jenis metode dan teknologi digunakan. Beberapa teknik dasarnya adalah:

Metode Maxam-Gilbert menggunakan pelabelan radioaktif dan untai murni yang diperoleh dari sampel ini digunakan dalam teknologi kloning lebih lanjut.

Metode pemutusan rantai dikembangkan oleh Sanger, juga disebut metode Sanger. Dalam metode ini lebih sedikit bahan kimia dan bahan radioaktif yang digunakan dibandingkan dengan metode Maxam-Gilbert. Metode ini digunakan pada DNA generasi pertama.

Ini hanya teknik dasar untuk pengurutan DNA, tetapi seiring waktu dan kemajuan, banyak teknik lain juga telah diperkenalkan, seperti:

Urutan senapan: metode sekuensing ini digunakan untuk Analisis fragmen DNA yang lebih panjang dari 1000 pasangan basa.

PCR jembatan: dalam kasusnya koloni DNA dibentuk oleh amplifikasi fragmen pada primer.

Selain teknik yang disebutkan di atas, beberapa teknik yang menggunakan biaya rendah dan dengan demikian memberikan hasil yang efektif. Beberapa dari mereka adalah:

  • Urutan padat
  • Urutan Illumina
  • Urutan polo
  • MPSS
  • Urutan SMRT dan banyak lagi.

Semua metode pengurutan ini memiliki metodologi dan proses yang berbeda, beberapa efektif untuk memberikan satu hasil dan lainnya dapat diterapkan di bidang yang berbeda. Penyebutan di atas hanyalah pandangan singkat dan singkat dari topik tersebut.

Jika Anda ingin mempelajari lebih lanjut tentang topik ini yang terkait dengan berbagai mata pelajaran seperti genetika, biologi molekuler, biologi sel, kunjungi myassignmenthelp.net.

Ini adalah situs online yang didasarkan pada penelitian dan teknologi yang berkembang dengan baik. Kami memiliki tim pengajar yang pekerja keras dan berpengalaman dari bidangnya masing-masing, mereka akan memberi Anda semua informasi tentang pengurutan DNA dengan cara yang diatur agar mudah dipahami. Layanan kami ramah siswa karena interaksi antara guru dan siswa selalu menghasilkan solusi yang efektif, mengesankan, dan keraguan.

Kami bekerja sesuai dengan silabus dan pedoman Anda tentang topik ini, sekarang jika Anda memiliki masalah dalam menulis tugas, bahkan dalam hal itu Anda dapat bergabung dengan situs bantuan tugas kami. Kami percaya pada pekerjaan dengan kualitas, maka semua materi yang kami sediakan akan menjelaskan topik Anda dengan cara terbaik dan membuat Anda mempelajari hal-hal dengan cara yang sangat jelas.

Kami tidak membatasi layanan kami hanya dalam memberikan Anda pekerjaan tertulis, tetapi fakultas kami yang sangat baik juga akan memberikan Anda kelas bimbingan belajar online, sehingga menyelesaikan semua keraguan Anda dan keluar dengan diskusi yang efektif.

Pengurutan DNA memiliki metode dan proses yang berbeda, tetapi berhubungan dengan guru kami akan memudahkan Anda untuk belajar dan mengingat hal-hal bahkan dalam waktu singkat dan nilai Anda pasti akan meningkat dengan semua pekerjaan tertulis yang diberikan kepada Anda oleh tim kami .

Bergabunglah dengan kami dan merasa lega karena kami memiliki solusi untuk semua masalah Anda yang akan memandu Anda ke dasar yang lebih baik dan mapan pada subjek.


Pengurutan DNA dengan metode dideoxy

Dalam reaksi sekuensing dideoksi dasar, primer oligonukleotida dianil ke templat DNA untai tunggal dan diperpanjang oleh DNA polimerase dengan adanya empat deoksiribonukleosida trifosfat (dNTPs), salah satunya berlabel 35S. Reaksi ini juga mengandung salah satu dari empat dideoksiribonukleosida trifosfat (ddNTPs), yang mengakhiri pemanjangan ketika dimasukkan ke dalam rantai DNA yang sedang tumbuh. Setelah selesainya reaksi sekuensing, produk dikenai elektroforesis pada gel poliakrilamida denaturasi resolusi tinggi dan kemudian diautoradiografi untuk memvisualisasikan sekuens DNA. Tiga variasi prosedur pengurutan dideoksi sedang digunakan dan disajikan dalam unit ini. Dalam prosedur "pelabelan/penghentian", rantai primer awalnya diperpanjang dan diberi label tanpa adanya penghentian ddNTP, sedangkan pada prosedur "Sanger" tradisional, pelabelan dan pemutusan rantai primer terjadi dalam satu langkah. Variasi terbaru dari metode sekuensing dideoksi adalah sekuensing siklus termal di mana campuran reaksi, yang mengandung DNA templat, primer, DNA polimerase termostabil, dNTPs, dan ddNTPs, mengalami putaran berulang dari langkah denaturasi, annealing, dan elongasi. Amplifikasi linier yang dihasilkan dari produk sekuensing memungkinkan lebih sedikit DNA templat untuk digunakan dan menghilangkan langkah anil primer independen dan denaturasi templat, yang diperlukan untuk pelabelan/penghentian atau prosedur Sanger. Penggunaan sekuenser fluoresen otomatis untuk pengurutan DNA dideoksi empat warna juga dijelaskan secara rinci.


Urutan Sanger:

Sanger dan rekan kerja mengembangkan metode pemutusan rantai pengurutan DNA, setelah beberapa tahun metode Maxam dan Gilberts. Metode ini juga dikenal sebagai metode sekuensing DNA generasi pertama.

NS metode pemutusan rantai juga disebut sebagai sekuensing dideoksinukleotida karena penggunaan tipe khusus ddNTP. ddNTP berbeda dari dNTP biasa. ia memiliki gugus hidrogen alih-alih gugus hidroksil di dNTP.

Gambar menunjukkan perbedaan antara gula ribosa, gula deoksiribosa, dan gula dideoksiribosa.

Ikatan fosfodiester tidak dapat terbentuk antara dua nukleotida yang berdekatan karena tidak adanya gugus hidroksil pada ddNTPs. Rantai nukleotida tidak dapat disintesis lebih lanjut dan karenanya dikenal sebagai metode pemutusan rantai.

  1. ekstraksi DNA: menggunakan salah satu protokol ekstraksi DNA
  2. amplifikasi PCR: menggunakan primer mengapit, dNTPs, ddNTPs, Taq DNA polimerase dan buffer PCR.
  3. Identifikasi fragmen yang diperkuat: menggunakan autoradiografi, PAGE, atau elektroforesis gel kapiler.

Proses pemutusan rantai dimulai dengan ekstraksi dan pemurnian DNA. Ekstraksi DNA dapat dilakukan dengan menggunakan metode proteinase K atau metode ekstraksi DNA fenol-kloroform. Atau kita juga bisa menggunakan metode kit berbasis kolom silika yang siap pakai.

Tujuan utama dari setiap metode ekstraksi DNA adalah untuk mencapai kemurnian di dekatnya

1,8 dan kuantitas lebih dari 100ng.

Setiap tabung berisi jumlah reagen PCR yang sama tetapi di setiap tabung, ddNTP tambahan ditambahkan seperti yang ditunjukkan pada tabel.

Primer mengapit adalah primer yang mengikat ke wilayah dekat urutan minat kita atau urutan apa yang akan kita baca.

Sekarang pada langkah berikutnya, Taq DNA polimerase menambahkan dNTPs ke untai DNA.

Di sini, DNA polimerase kesetiaan tinggi tidak diperlukan. Taq polimerase normal memperluas untai DNA yang sedang tumbuh dengan penambahan dNTPs. Menariknya, setelah menambahkan ddNTP alih-alih dNTP, ekspansi rantai dihentikan atau dihentikan.

Proses terminasi selesai dalam 4 tabung berbeda untuk 4 ddNTP berbeda. Misalnya, dalam tabung ddATP, itu mengakhiri rantai di semua posisi di mana dATP akan mengikat.

Produk PCR yang diperkuat dimuat ke elektroforesis gel poliakrilamida. Fragmen DNA bermigrasi ke dalam gel berdasarkan ukuran fragmen. Fragmen yang lebih kecil berjalan lebih cepat menuju muatan positif daripada fragmen yang lebih besar.

Sebelum PAGE dijalankan, fragmen DNA yang telah diamplifikasi didenaturasi lebih lanjut oleh panas. Tergantung pada jenis pelabelan gel kemudian dianalisis di bawah sinar UV atau film sinar-X. Pola pita dari produk yang diperkuat ditunjukkan pada gambar di bawah ini,

Metode pemutusan rantai Sangers dari sekuensing DNA.

Urutan Sanger adalah metode standar emas untuk penelitian serta dalam diagnosis, saat ini. Karena pengaturannya yang mudah dan reproduktifitas yang tinggi. otomatisasinya telah dilakukan dengan mudah.

Secara tradisional, hasil diinterpretasikan pada PAGE secara manual tetapi sekarang, skenarionya diubah. Proses ini sepenuhnya atau sebagian otomatis. Detektor mendeteksi sinyal fluoresensi setiap kali rantai dihentikan. Selanjutnya, sinyal direkam dan dianalisis secara komputasi.

Perangkat lunak komputasi menghasilkan berbagai puncak fluoresensi tergantung pada jumlah fluoresensi yang dipancarkan. Ilustrasi hipotetis hasil sekuensing Sanger ditunjukkan pada gambar di bawah ini,

Bagaimana cara menginterpretasikan hasil PAGE untuk pengurutan Sanger?

Bagian ini sangat penting, saya akan mengajari Anda bagaimana Anda dapat menginterpretasikan hasil pengurutan. Meskipun itu adalah jenis ikhtisar.

Sekarang perhatikan gambar di atas,

Prinsip elektroforesis menyatakan bahwa fragmen DNA yang lebih kecil bermigrasi lebih cepat daripada yang lebih besar. Jadi fragmen di sisi positif adalah yang terkecil. Mulai membaca urutan dari itu.

Poin pertama dalam pengurutan DNA adalah mencocokkan ukuran DNA. jika pita yang diperoleh dalam gel dan urutan nukleotida DNA kita serupa, reaksi selesai dengan benar. Misalnya, jika panjang urutan Anda adalah 16, maka 16 pita harus ada ke dalam gel.

Mulailah membaca dari bawah. Urutan DNA dimulai dengan “C” sebagai fragmen terakhir DNA yang diakhiri dengan ddCTP. Atur urutan yang ditunjukkan pada gambar, sesuai.


Dalam mesin pengurutan kapiler, fragmen DNA dipisahkan berdasarkan ukuran melalui kapiler serat akrilik yang panjang, tipis (bukan gel elektroforesis, seperti pada metode Sanger).

  1. Sampel yang mengandung fragmen DNA disuntikkan ke dalam kapiler. Ini dilakukan dengan mencelupkan kapiler dan elektroda ke dalam larutan sampel, dan mengalirkan arus listrik sebentar. Hal ini menyebabkan fragmen DNA bermigrasi ke ujung kapiler.
  2. Setelah sampel disuntikkan, medan listrik diterapkan kembali, untuk mendorong fragmen DNA melalui kapiler.
  3. Laser pendeteksi fluoresensi, yang terpasang di dalam mesin, kemudian menembak melalui serat kapiler, menyebabkan label berwarna pada fragmen DNA, berpendar. Setiap terminator dasar diberi label dengan warna yang berbeda: A = Hijau, C = Biru, G = Kuning dan T = Merah.
  4. Warna dasar fluoresen dideteksi oleh kamera, dan direkam oleh mesin pengurutan.
  5. Warna basa kemudian ditampilkan pada komputer sebagai grafik puncak berwarna berbeda. Seperti yang ini:

Kredit gambar: Genome Research Limited

Diameter kapiler yang kecil memungkinkan penggunaan medan listrik yang sangat tinggi, dan akibatnya, pemisahan fragmen pengurutan DNA yang sangat cepat.


Urutan senapan dan menangani bagian berulang, animasi 3D dengan narasi dasar

Proyek swasta itu menghancurkan genom menjadi potongan-potongan dengan ukuran berbeda dan menggunakan model matematika dan peta lain untuk merekonstruksi genom dari potongan-potongan ini. (Lokasi DNAi: Genom > Proyek > Menyatukannya > Animasi > Seluruh genom senapan-swasta)

Sekuensing senapan adalah metode yang digunakan oleh proyek genom pribadi. Urutan senapan membutuhkan banyak salinan genom, yang secara efektif diledakkan menjadi jutaan fragmen kecil. Setiap fragmen kemudian diurutkan. Fragmen-fragmen kecil dirakit menggunakan sejumlah besar daya komputer untuk mencocokkan bagian yang tumpang tindih. Kelemahan dari metode ini muncul ketika berhadapan dengan urutan berulang. Seringkali tidak ada cara untuk mengetahui berapa lama urutan pengulangan atau di mana dari banyak kemungkinan posisi yang berbeda, fragmen tumpang tindih. Bahkan perangkat lunak yang sangat kuat yang digunakan untuk membuat urutan senapan genom manusia tidak dapat mengatasi hal ini. Jadi Celera, perusahaan swasta yang mengandalkan pendekatan ini, harus menggunakan data publik untuk mengisi kekosongan yang ditinggalkan oleh pengulangan.

pengurutan senapan,perangkat lunak canggih,kekuatan komputer,proyek genom,genom manusia,fragmen,kelemahan,narasi,fragmen,perusahaan swasta,gap,urutan,animasi

Konten Terkait

15477. Proyek Genom Manusia publik: pemetaan genom, pengurutan, dan perakitan kembali. animasi 3D.

Proyek Genom Manusia publik: pemetaan genom, pengurutan, dan perakitan kembali.

15367. Menggunakan data dari proyek publik, Craig Venter

Craig Venter, pemimpin usaha swasta di Celera Genomics, berbicara tentang ketergantungan perusahaannya pada data publik untuk perakitan kembali rangkaian Celera.

15365. Senapan seluruh genom, Craig Venter

Craig Venter, pemimpin upaya genom pribadi, berbicara tentang teknik "senapan seluruh genom" yang digunakan oleh Celera Genomics untuk mengurutkan genom manusia.

15538. Urutan Genom: Teknik Shotgun, animasi 3D tanpa audio

Pengurutan Genom: Teknik Shotgun.

16812. Animasi 39: Genom adalah seluruh rangkaian gen.

James Watson menjelaskan pengurutan genom manusia menggunakan penanda dan BAC, dan Craig Venter menjelaskan menggunakan pustaka cDNA, EST, dan pengurutan shotgun.

15340. Proyek Genom Manusia lebih dari sekedar pengurutan, Ari Patrinos

Ari Patrinos, direktur upaya pengurutan Departemen Energi AS, berbicara tentang tujuan proyek genom publik yang melampaui tujuan proyek swasta.

15479. Metode Sanger dari sekuensing DNA, animasi 3D dengan narasi

Metode pengurutan DNA yang dikembangkan oleh Fred Sanger membentuk dasar dari reaksi pengurutan "siklus" otomatis saat ini.

15169. Proses pengurutan publik, John Sulston

Pemenang Nobel John Sulston, tokoh kunci dalam upaya pengurutan Inggris, berbicara tentang pemecahan DNA sehingga urutannya dapat dipasang kembali.

15291. Menemukan gen dalam genom manusia, Ewan Birney

Untuk draf pertama dari urutan genom, kedua tim bekerja untuk mengidentifikasi jumlah gen manusia. Di sini, Ewan Birney, "pria nomor" dari proyek genom publik, menjelaskan bagaimana gen dapat dikenali dan data dari proyek genom digunakan.


Anda mungkin juga Menyukai

Tikus transgenik digunakan untuk mempelajari fungsi gen dan regulasi gen. Dan dalam penelitian biologi molekuler, analisis sekuens DNA merupakan dasar penelitian lebih lanjut dan modifikasi gen target. cdgenomics 11 Oktober 2015

Saya perhatikan bahwa di sini disebutkan metode senapan tetapi bukan metode lain seperti sanger atau pengurutan generasi berikutnya. Mengapa? seHiro 15 Juni 2011

@TheGraham - Hei, saya rasa saya bisa menjawab pertanyaan itu tentang apakah informasi GenBank semuanya berasal dari The Human Genome Project. Jawaban yang jelas dan sederhana: tidak.

GenBank hanya bisa menjadi sebesar ini dengan membiarkan orang berkolaborasi sebanyak yang mereka inginkan. Basis data memiliki kontrol kualitas yang cukup ketat -- mereka akan memeriksa dengan cermat setiap hal sebelum menambahkannya ke basis data -- tetapi mereka beroperasi pada pengiriman data dari masing-masing laboratorium di samping kumpulan informasi yang disediakan oleh pusat pengurutan gen.

Saya pikir GenBank adalah ide yang keren, bahkan jika saya tidak begitu memahami hal-hal pengurutan gen ini dengan baik. Informasinya tidak masuk akal bagi saya, tapi saya yakin itu seperti harta karun yang terpendam bagi seorang ilmuwan. TheGraham 13 Juni 2011

Beberapa orang di sini berbicara tentang GenBank, yang telah saya baca sebelumnya, dan saya ingin menyebutkan bahwa meskipun proyek ini disebut "Proyek Genom Manusia", itu tidak hanya memetakan urutan gen manusia.

Proyek Genom Manusia juga telah memetakan DNA untuk hewan yang biasanya dirujuk untuk eksperimen ilmiah, seperti lalat buah dan tikus laboratorium. Juga, saya tidak yakin apakah datanya berasal dari Proyek Genom Manusia, tetapi GenBank juga menampung ratusan ribu urutan lainnya, termasuk banyak mikroba.

Pada 2011, GenBank tidak hanya menyimpan semua informasi pemetaan gen yang pernah kami temukan untuk DNA manusia, tetapi juga urutan nukleotida lebih dari 300.000 organisme lain, lengkap dengan catatan penelitian pendukung dari buku dan bahkan penjelasan dari para peneliti. Betapa banyak informasi ilmiah yang luar biasa di sana! hanley79 11 Juni 2011

@malmal - Saya tidak tahu tentang setiap proses sekuensing gen di planet ini, tetapi Proyek Genom Manusia memang memiliki satu basis data besar tempat ia menyimpan sekuens DNA yang dipetakan.

Basis data tersebut disebut GenBank, dan merupakan basis data nomor satu yang paling banyak direferensikan untuk penelitian biologi di mana pun di dunia. Ia juga menawarkan akses domain publik gratis dan terbuka ke seluruh basis data kepada siapa saja yang mengunjungi situs web mereka -- sangat keren!

GenBank telah ada sejak tahun 1982, dan telah berkembang menjadi lebih dari 61 juta sekuens gen selama bertahun-tahun.

Jika pertanyaan Anda adalah tentang "di mana" harfiah, ingatlah bahwa kita berurusan dengan internet. Karena database komputer sebenarnya tidak harus berada di satu tempat berkat internet, komputer fisik sebenarnya yang menyimpan database berada di Amerika Serikat, di Jepang, dan di Eropa, meskipun secara teknis GenBank berada di bawah pemerintah Amerika Serikat. yurisdiksi.

Semoga ini bisa sedikit meredakan rasa penasaran! Jika Anda tertarik dengan hal ini, Anda harus mencari Genbank -- membaca tentangnya sangat menarik. malmal 10 Juni 2011

@turkay1 - Apa yang Anda katakan tentang pemetaan 10.000 DNA mikroba di China dan apakah mereka akan membaginya dengan seluruh dunia membuat saya sangat penasaran -- di mana kami menyimpan semua pekerjaan DNA yang dipetakan ini? Maksud saya, apakah ada satu database besar untuk semua orang?

Saya kira terlalu ideal untuk berpikir bahwa berbagai negara akan memiliki database yang mereka kerjakan bersama, tapi saya percaya setiap negara memiliki database yang besar.

Tampaknya bagi saya jika tidak ada database resmi sekuensing gen yang telah dibuat untuk proyek genom ini, maka orang mungkin tidak tahu apa yang telah dilakukan orang lain sebelumnya dan mulai memetakan DNA yang telah dipetakan secara tidak sengaja.

Apakah ada semacam registri yang gennya telah dipetakan, tetapi setiap orang menyimpan data mereka sendiri di berbagai basis data mereka sendiri, mungkin? Aku sangat penasaran sekarang. aishia 8 Juni 2011

Pemetaan gen adalah alat revolusioner di berbagai bidang, tetapi saya pikir salah satu kegunaan paling praktisnya adalah sebagai alat memerangi kejahatan.

Menggunakan urutan DNA, pemetaan gen adalah teknik yang memungkinkan ahli forensik untuk menyelidiki TKP dan menguji darah yang ditemukan di sana, misalnya. Dalam situasi lain, pemetaan gen dapat digunakan untuk menguji sampel air mani yang diambil dari korban pemerkosaan dan kemudian mengidentifikasi penyerang tanpa keraguan daripada mengandalkan kesaksian dan bukti yang lebih tradisional.

Pemetaan DNA sebagai alat forensik diperkenalkan pada pertengahan 1980-an, dan pada saat itu disebut sebagai "sidik jari DNA" karena, seperti sidik jari, tidak ada dua sampel DNA yang persis sama.

Pemetaan gen tidak hanya membantu penyelidik polisi untuk menangkap penjahat yang tepat -- tetapi juga akhirnya membuktikan ribuan orang yang tidak bersalah yang dipenjarakan secara salah berdasarkan bukti investigasi dari sebelum forensik DNA ada. Siapa bilang sains tidak memengaruhi kehidupan kita sehari-hari? fify 8 Juni 2011

Ya, negara lain juga melakukan pengurutan gen. Saya pikir Jepang, Kanada, Cina adalah beberapa yang besar. Tetapi sebagian besar penelitian sejauh ini sedang dilakukan di sini di AS. Bahkan, itu bahkan tidak sebanding, AS mungkin memiliki sepuluh kali lebih banyak proyek pengurutan genetik daripada Jepang. Jadi kami pasti memimpin dunia dalam penelitian ini.

National Institutes of Health mendanai sebagian besar proyek kami, diikuti oleh Departemen Energi. Saya pikir Departemen Pertanian juga mendanai beberapa proyek pengurutan gen, meskipun saya tidak tahu berapa banyak. Saya tidak berpikir bahwa mereka mendanai dari jarak jauh dengan apa yang didanai Departemen Energi. candyquilt 8 Juni 2011

Saya membaca bahwa pengurutan gen tidak hanya dilakukan pada manusia, tetapi juga pada bakteri, hewan, serangga, dan tumbuhan. Beberapa ilmuwan benar-benar percaya bahwa pengurutan gen bakteri dan mikroba lain bahkan lebih penting daripada pengurutan genetik manusia atau hewan. Saya setuju dengan itu karena banyak penyakit disebabkan oleh mikroba, mengetahui urutan genetik mereka akan terbukti berguna dalam membuat obat baru untuk melawan mereka.

Saya membaca tentang proyek besar yang sedang berlangsung sekarang ini. Anehnya, itu tidak terjadi di AS, tetapi di China. Institut Genomik Beijing sedang bekerja untuk mengurutkan gen 10.000 mikroba.

Saya benar-benar berharap bahwa proyek serupa sedang berlangsung di AS Meskipun saya kira Institut Beijing akan membagikan temuan mereka dengan seluruh dunia. Saya dapat melihat proyek ini membuat gelombang di dunia medis ketika selesai dan perusahaan farmasi mungkin akan menjadi yang pertama dalam antrean untuk mendapatkannya. pirus 8 Juni 2011

Saya percaya pengurutan gen dimulai dengan Proyek Genom Manusia di awal 90-an. Mereka tidak hanya menemukan urutan DNA tetapi juga membuat database untuk itu yang disebut GenBank.

Bagian besar tentang database ini adalah bahwa itu benar-benar publik. Jadi setiap ilmuwan yang melakukan pekerjaan di bidang ini dapat menggunakannya.

Alasan mengapa pengurutan menjadi sejauh ini dan sekarang kami dapat mendiagnosis penyakit genetik sedini mungkin mungkin berkat database ini. Saya memiliki harapan bahwa kita akan dapat mencegah banyak penyakit ini dalam waktu dekat dengan pengurutan gen.


Tonton videonya: Shotgun sequencing (Agustus 2022).