Informasi

Bahan kimia asam/basa yang dapat digunakan tanpa tudung ekstraksi?

Bahan kimia asam/basa yang dapat digunakan tanpa tudung ekstraksi?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Saya perlu menggunakan beberapa pelarut daging untuk tesis saya, saya bekerja di antropologi forensik, tetapi di universitas saya, kami tidak diperbolehkan menggunakan yang mungkin sangat berbahaya (seperti HF atau HCl karena asapnya).

Teman saya menyarankan saya untuk menggunakan CaO dan KOH, karena Anda hanya membutuhkan peralatan lab biasa. Apakah Anda memiliki saran lain yang mungkin berguna?

Terima kasih! Semua bantuan yang bisa saya dapatkan sangat dihargai


Asam dan Basa yang Kita Gunakan Dalam Kehidupan Sehari-hari

Asam dan Basa ditemui setiap hari dalam kimia dan kehidupan kita sehari-hari. Asam dan basa menjadi bagian penting dan tak terpisahkan dari mata pencaharian kita. Mereka memainkan peran yang efisien di dalam atau di luar tubuh kita. Dari pembentukan makanan hingga penguraian zat apa pun, asam dan basa memainkan peran penting dalam kehidupan kita sehari-hari. Mari kita periksa kegunaannya dalam kehidupan kita sehari-hari.


Deterjen untuk Lisis Sel dan Ekstraksi Protein

Deterjen adalah molekul amfipatik, artinya mengandung "ekor" nonpolar yang memiliki karakter alifatik atau aromatik dan "kepala" polar. Karakter ionik dari gugus kepala polar membentuk dasar untuk klasifikasi luas deterjen, mereka mungkin ionik (bermuatan, baik anionik atau kationik), nonionik (tidak bermuatan), atau zwitterionik (memiliki gugus bermuatan positif dan negatif tetapi dengan muatan bersih nol ).

Deterjen dalam larutan

Seperti komponen membran biologis, deterjen memiliki sifat asosiasi hidrofobik sebagai hasil dari kelompok ekor nonpolarnya. Namun demikian, deterjen itu sendiri larut dalam air. Akibatnya, molekul deterjen memungkinkan dispersi (kelarutan) senyawa hidrofobik yang tidak larut dalam air ke dalam media berair, termasuk ekstraksi dan pelarutan protein membran.

Deterjen pada konsentrasi rendah dalam larutan air membentuk lapisan tunggal pada antarmuka udara-cair. Pada konsentrasi yang lebih tinggi, monomer deterjen berkumpul menjadi struktur yang disebut misel. Misel adalah agregat koloid yang stabil secara termodinamik dari monomer deterjen dimana ujung nonpolar diasingkan ke dalam, menghindari paparan air, dan ujung kutub berorientasi ke luar dalam kontak dengan air.

Struktur ideal dari misel deterjen.

Baik jumlah monomer deterjen per misel (nomor agregasi) dan kisaran konsentrasi deterjen di atas yang membentuk misel (disebut konsentrasi misel kritis, CMC) adalah sifat khusus untuk setiap deterjen tertentu (lihat tabel). Suhu kritis misel (CMT) adalah suhu terendah di mana misel dapat terbentuk. CMT sesuai dengan apa yang dikenal sebagai titik awan karena misel deterjen membentuk suspensi kristal pada suhu di bawah CMT dan jernih kembali pada suhu di atas CMT.

Sifat deterjen dipengaruhi oleh kondisi eksperimental seperti konsentrasi, suhu, pH buffer dan kekuatan ion, dan adanya berbagai aditif. Misalnya, CMC deterjen nonionik tertentu menurun dengan meningkatnya suhu, sedangkan CMC deterjen ionik menurun dengan penambahan counter ion sebagai akibat dari tolakan elektrostatik berkurang antara kelompok kepala bermuatan. Dalam kasus lain, aditif seperti urea efektif mengganggu struktur air dan menyebabkan penurunan CMC deterjen. Umumnya, peningkatan dramatis dalam jumlah agregasi terjadi dengan meningkatnya kekuatan ion.

Deterjen dapat mengalami denaturasi atau non-denaturasi sehubungan dengan struktur protein. Deterjen denaturasi dapat berupa anionik seperti natrium dodesil sulfat (SDS) atau kationik seperti etil trimetil amonium bromida. Deterjen ini benar-benar mengganggu membran dan mendenaturasi protein dengan memutus interaksi protein-protein. Deterjen non-denaturasi dapat dibagi menjadi deterjen nonionik seperti Triton X-100, garam empedu seperti kolat, dan deterjen zwitterionik seperti CHAPS.

Sifat deterjen umum.

DeterjenJenisAgg.#‡MW
mono
(misel)
CMC
mM
(% b/v)
Awan
titik
°C
dapat didialisis
Termo Ilmiah Triton X-100Nonionik140647 (90K)0.24 (0.0155)64Tidak
Termo Ilmiah Triton X-114Nonionik537 ( – )0.21 (0.0113)23Tidak
NP-40Nonionik149617 (90K)0.29 (0.0179)80Tidak
Termo Ilmiah Brij-35Nonionik401225 (49K)0.09 (0.0110)>100Tidak
Termo Ilmiah Brij-58Nonionik701120 (82K)0.08 (0.0086)>100Tidak
Thermo Ilmiah Tween 20Nonionik1228 ( – )0.06 (0.0074)95Tidak
Termo Ilmiah Tween 80Nonionik601310 (76K)0.01 (0.0016)Tidak
Oktil glukosidaNonionik27292 (8K)23-24 (

Agg.# = Nomor agregasi, yaitu jumlah molekul per misel.

Solusi deterjen murni

Meskipun deterjen tersedia dari beberapa sumber komersial dan digunakan secara rutin di banyak laboratorium penelitian, pentingnya kemurnian dan stabilitas deterjen tidak dihargai secara luas. Deterjen sering mengandung jejak kotoran dari pembuatannya. Beberapa pengotor ini, terutama peroksida yang ditemukan di sebagian besar deterjen nonionik, akan merusak aktivitas protein. Selain itu, beberapa jenis deterjen mudah teroksidasi saat terkena udara atau sinar UV, menyebabkan mereka kehilangan sifat dan potensinya sebagai agen pelarut. Kami menawarkan beberapa deterjen dengan kemurnian tinggi dan rendah peroksida yang dikemas dalam gas nitrogen dalam ampul kaca bening. Solusi Deterjen Thermo Scientific Surfact-Amps ini memberikan kenyamanan, kualitas, dan konsistensi yang tak tertandingi untuk semua aplikasi deterjen. Kit sampler mencakup 10 deterjen murni yang berbeda (tujuh dalam format Surfact-Amps dan tiga dalam bentuk padat).

Belajarlah lagi

Pilih produk

Struktur membran sel

Faktor utama yang menentukan perilaku dan interaksi molekul dalam sampel biologis adalah hidrofilisitas atau hidrofobisitasnya. Sebagian besar protein dan molekul lain dengan gugus fungsi bermuatan atau polar larut (atau bercampur) dalam air karena mereka berpartisipasi dalam struktur antarmolekul air yang sangat teratur dan terikat hidrogen. Beberapa protein lain (atau setidaknya bagian dari protein), serta lemak dan lipid, tidak memiliki gugus fungsi polar atau bermuatan, akibatnya, mereka dikeluarkan dari interaksi teratur air dengan molekul polar lainnya dan cenderung bergabung bersama dalam struktur yang memiliki permukaan minimal. daerah kontak dengan lingkungan kutub. Asosiasi molekul nonpolar dalam larutan berair ini biasa disebut daya tarik hidrofobik, meskipun lebih akurat dipahami sebagai pengecualian dari lingkungan hidrofilik.

Pembentukan dan stabilitas membran biologis menghasilkan sebagian besar dari daya tarik hidrofobik fosfolipid, yang membentuk lembaran bilayer yang memiliki "ekor" lipid hidrofobik yang berorientasi dalam ketebalan lembaran dan kelompok "kepala" polar yang berorientasi pada lingkungan berair luar dan dalam. Protein membran benar-benar menjangkau ketebalan membran atau tertanam di satu sisi membran sesuai dengan struktur rantai samping asam amino hidrofobik dan hidrofilik dan gugus fungsi lainnya.

Gangguan membran, pengikatan protein dan solubilisasi

Umumnya, konsentrasi moderat deterjen ringan (yaitu, nonionik) membahayakan integritas membran sel, sehingga memfasilitasi lisis sel dan ekstraksi protein terlarut, seringkali dalam bentuk asli. Dengan menggunakan kondisi penyangga tertentu, berbagai deterjen secara efektif menembus antara lapisan ganda membran pada konsentrasi yang cukup untuk membentuk misel campuran dengan fosfolipid terisolasi dan protein membran.

Lisis sel berbasis deterjen. Baik reagen lisis sel denaturasi dan non-denaturasi dapat digunakan untuk prosedur ekstraksi protein.

Deterjen denaturasi seperti SDS mengikat protein membran (hidrofobik) dan non-membran (larut dalam air, hidrofilik) pada konsentrasi di bawah CMC (yaitu, sebagai monomer). Reaksi berlangsung dalam kesetimbangan hingga jenuh. Oleh karena itu, konsentrasi bebas dari monomer menentukan konsentrasi deterjen. Pengikatan SDS bersifat kooperatif (yaitu, pengikatan satu molekul SDS meningkatkan kemungkinan bahwa molekul SDS lain akan mengikat protein itu) dan mengubah sebagian besar protein menjadi batang kaku yang panjangnya sebanding dengan berat molekul.

Deterjen non-denaturasi seperti Triton X-100 memiliki kepala nonpolar kaku dan besar yang tidak menembus ke dalam protein yang larut dalam air akibatnya, mereka umumnya tidak mengganggu interaksi asli dan struktur protein yang larut dalam air dan tidak memiliki sifat pengikatan kooperatif. Efek utama dari deterjen non-denaturasi adalah untuk mengasosiasikan dengan bagian hidrofobik dari protein membran, sehingga memberikan miscibility untuk mereka.

Pada konsentrasi di bawah CMC, monomer deterjen mengikat protein yang larut dalam air. Di atas CMC, pengikatan deterjen ke protein bersaing dengan asosiasi diri molekul deterjen menjadi misel. Akibatnya, tidak ada peningkatan secara efektif dalam monomer deterjen yang terikat protein dengan meningkatnya konsentrasi deterjen di luar CMC.

Monomer deterjen melarutkan protein membran dengan mempartisi ke dalam bilayer membran. Dengan meningkatnya jumlah deterjen, membran mengalami berbagai tahap pelarutan. Tahap awal adalah lisis atau pecahnya membran. Pada deterjen: rasio molar lipid membran 0,1:1 sampai 1:1, lapisan ganda lipid biasanya tetap utuh tetapi ekstraksi selektif dari beberapa protein membran terjadi. Meningkatkan rasio menjadi 2:1, terjadi pelarutan membran, menghasilkan misel campuran. Ini termasuk misel fosfolipid-deterjen, misel deterjen-protein, dan misel lipid-deterjen-protein. Pada rasio 10:1, semua lipid membran asli: interaksi protein secara efektif ditukar dengan deterjen: interaksi protein.

Jumlah deterjen yang dibutuhkan untuk ekstraksi protein yang optimal tergantung pada CMC, jumlah agregasi, suhu dan sifat membran dan deterjen. Buffer pelarutan harus mengandung deterjen yang cukup untuk menyediakan lebih dari 1 misel per molekul protein membran untuk membantu memastikan bahwa molekul protein individu diisolasi dalam misel terpisah.

Deterjen yang digunakan untuk lisis sel. Karakteristik utama deterjen denaturasi dan non-denaturasi yang digunakan untuk ekstraksi protein.


9.B. PERTIMBANGAN DESAIN LABORATORIUM UMUM

9.B.1. Hubungan Antara Ruang Laboratorium Basah dan Ruang Lainnya

Laboratorium modern, khususnya di bidang akademik, sering kali memiliki ruang yang berdekatan yang mencakup laboratorium basah, laboratorium komputer, instrumen, ruang tulis, area kantor, dan ruang lain dengan berbagai tingkat penggunaan dan bahaya bahan kimia. Mempertahankan budaya keselamatan yang positif dan pada saat yang sama memenuhi kebutuhan keselamatan dan kenyamanan personel laboratorium merupakan tantangan dalam situasi ini.

9.B.1.1. Hubungan Antara Laboratorium dan Ruang Kantor

Hampir semua personel laboratorium membutuhkan ruang penunjang laboratorium dan kantor. Keinginan mereka untuk mengetahui prosedur dan selalu hadir di laboratorium biasanya menuntut agar ruang kantor ditempatkan di dekat laboratorium. Kebutuhan akan keselamatan personel, teknologi evolusioner yang memungkinkan penelitian berbasis komputer dan pemantauan data di luar laboratorium, serta keinginan untuk mendorong interaksi yang lebih baik antara peneliti telah mendorong kantor di luar laboratorium.

Menempatkan semua kantor di luar lingkungan laboratorium memungkinkan ruang kerja yang lebih aman di mana makanan dapat dikonsumsi, pekerjaan yang tenang dapat dilakukan, dan lebih banyak kertas dan buku dapat disimpan. Menempatkan zona kantor sangat dekat atau berdekatan dengan laboratorium untuk akses mudah dan komunikasi sangat diinginkan.

Beberapa laboratorium memiliki ruang kantor di dalam area penelitian. Dalam desain ini, yang terbaik adalah memiliki pemisahan yang jelas antara area laboratorium dan area kantor menggunakan partisi atau, minimal, ruang lorong, tetapi sebaiknya menggunakan dinding dan pintu yang dapat ditutup. Penghuni tidak harus berjalan melalui area laboratorium untuk keluar dari ruang kantor mereka. Pengunjung dan mahasiswa tidak perlu berjalan melalui laboratorium untuk menuju kantor peneliti, karena mereka tidak memiliki alat pelindung diri (APD). (Lihat Vignette 9.1.)

VIGNETTE 9.1

Penggunaan yang tepat dari alat pelindung diri di ruang bersama. Dalam kedua insiden ini, laboratorium penelitian berisi ruang tulis dengan workstation komputer dan meja yang dipisahkan dari bagian kerja laboratorium hanya dengan (lebih )

9.B.2. Desain Laboratorium Terbuka

Secara tradisional, laboratorium dirancang untuk kelompok penelitian individu dengan dinding yang memisahkan laboratorium dan ruang pendukung. Ukuran kelompok berkisar antara 2 sampai 10 orang, dan sebagian besar kelompok benar-benar mandiri, masing-masing dengan peralatan dan fasilitasnya sendiri (Gambar 9.1).

GAMBAR 9.1

Desain laboratorium terbuka versus tertutup. Gambar di atas adalah contoh desain laboratorium tertutup yang khas dengan empat laboratorium terpisah. Tiga dinding memisahkan ruang dan memanjang dari lantai ke langit-langit, tanpa ruang bersama. Angka paling bawah adalah (lebih.)

Sejak tahun 1990-an, ada kecenderungan bagi para peneliti untuk berkolaborasi dalam lintas disiplin ilmu alam, ahli kimia, ahli biologi, fisikawan, insinyur, dan ilmuwan komputer bekerja sama untuk tujuan yang sama. Pada saat yang sama, perancang laboratorium telah pindah untuk membuka laboratorium multi-modul yang memungkinkan berbagai konfigurasi untuk pekerjaan kasus dan pengaturan peralatan. Laboratorium ini sering mendukung tim besar atau banyak dan dikonfigurasi dengan perabotan yang dapat dipindahkan.

Bahkan ketika tidak menggunakan pendekatan multidisiplin, banyak fasilitas telah pindah ke laboratorium yang lebih besar dan lebih terbuka dengan keyakinan bahwa bekerja dalam tim meningkatkan produktivitas secara keseluruhan, mempromosikan komunikasi terbuka, dan memfasilitasi berbagi sumber daya. Ukuran tim, dalam beberapa disiplin ilmu, telah meningkat dan seringkali mencapai 12 hingga 20 individu.

9.B.2.1. Pertimbangan untuk Desain Laboratorium Terbuka

Ada kelebihan dan kekurangan desain laboratorium terbuka.

Kekurangan dan keterbatasan termasuk

Tim desain harus bekerja dengan tim peneliti untuk menemukan solusi yang mengakomodasi kebutuhan peneliti sebanyak mungkin. Kombinasi ruang laboratorium terbuka dengan area yang lebih kecil yang didedikasikan untuk fungsi khusus seringkali diperlukan.

9.B.3. Laboratorium dan Akses Tertutup

Ruang laboratorium yang tertutup atau terpisah seringkali diperlukan untuk fungsi tertentu karena sifat operasi, kebutuhan peralatan, atau masalah keamanan. Area ini mungkin atau mungkin tidak dipisahkan dengan pintu. Kebutuhan pintu dan kontrol akses harus diperiksa dengan cermat untuk persyaratan kode, protokol keselamatan, dan masalah penahanan.

Masalah-masalah berikut harus dipertimbangkan:

Contoh operasi atau aktivitas yang mungkin memerlukan pemisahan dari laboratorium utama terdapat pada Tabel 9.1.

TABEL 9.1

Beberapa Kegiatan, Peralatan, atau Bahan Yang Mungkin Memerlukan Pemisahan dari Laboratorium Utama.

Penggunaan bahan berbahaya yang luar biasa mungkin memerlukan area khusus untuk pekerjaan tersebut guna mengelola risiko keamanan, keselamatan, dan lingkungan secara paling efisien.

9.B.4. Kaki Linier Setara dari Ruang Kerja

Saat merancang ruang laboratorium baru, pertimbangkan kaki linier ekuivalen (ELF) permukaan kerja di dalam laboratorium. ELF dapat dibagi menjadi dua kategori: bangku dan peralatan. Bench ELF adalah panjang meja yang diperlukan tempat instrumen dapat dipasang dan tempat pekerjaan persiapan dilakukan, serta panjang tudung kimia laboratorium. Peralatan ELF mencakup panjang ruang lantai untuk peralatan yang tidak muat di bangku. Biasanya, setiap dua personel laboratorium yang pekerjaannya sebagian besar melibatkan bahan kimia berbahaya harus memiliki setidaknya satu tudung kimia, dan ini harus cukup besar untuk menyediakan minimal 3 kaki linier kepada setiap orang, tetapi bisa juga 8 kaki atau lebih tergantung pada rencana kegiatan dan jenis kimia.

Laboratorium kimia tipikal dirancang untuk menyediakan 28 hingga 30 ELF per orang. Kontrol kualitas, biologi, dan laboratorium analitik berkisar antara 20 hingga 28 ELF per orang. Laboratorium kendali mutu dan produksi cenderung berada di ujung bawah kisaran ini, sedangkan laboratorium penelitian berada pada atau di atas kisaran ujung atas. Jumlah ini sudah termasuk ruang penunjang di luar laboratorium yang dibutuhkan. Nilai-nilai ini dapat sangat bervariasi dan harus ditangani dengan hati-hati untuk setiap proyek.

9.B.5. Tata Letak dan Perabotan Laboratorium

9.B.5.1. Kemampuan beradaptasi

Frekuensi perubahan penggunaan laboratorium telah membuat diinginkan untuk menyediakan perabot dan layanan yang dapat dipindahkan dan disesuaikan dengan cepat. Meskipun beberapa layanan dan permukaan akan menjadi elemen tetap di laboratorium mana pun, seperti bak cuci dan tudung kimia, ada beberapa opsi yang tersedia untuk memenuhi kebutuhan yang dapat disesuaikan untuk berbagai jenis penelitian.

Praktik desain saat ini adalah menempatkan elemen tetap seperti tudung kimia laboratorium dan wastafel di sekeliling laboratorium, memastikan mobilitas maksimum peralatan interior dan furnitur. Meskipun pekerjaan kasus tetap umum dilakukan di perimeter, bagian yang dapat dipindahkan berada di tengah untuk memaksimalkan fleksibilitas. Bagian tengah laboratorium dikonfigurasikan dengan kereta dorong yang kokoh, meja yang dapat disesuaikan, dan rak peralatan.

Tren lain untuk bangunan laboratorium baru adalah merancang ruang interstisial antara lantai dan memiliki semua utilitas di atas langit-langit. Ruang interstisial cukup besar untuk memungkinkan pekerja pemeliharaan mengakses utilitas ini dari atas langit-langit baik untuk servis rutin maupun untuk memindahkan pipa ledeng dan utilitas lainnya saat penelitian menuntut perubahan.

Dimana ruang interstisial tidak memungkinkan, operator layanan overhead dapat digantung dari bagian bawah sistem lantai struktural. Operator layanan ini mungkin memiliki koneksi cepat ke berbagai utilitas, seperti ventilasi pembuangan lokal, kabel komputer, lampu, dan outlet listrik.

9.B.5.2. Pekerjaan Kasus, Perabotan, dan Perlengkapan

Pekerjaan kasus harus tahan lama dan dirancang dan dibangun dengan cara yang memungkinkan penggunaan jangka panjang, penggunaan kembali, dan relokasi. Beberapa bahan mungkin tidak tahan dengan baik kimia intensif atau konfigurasi ulang laboratorium. Bahan harus mudah dibersihkan dan diperbaiki. Untuk kamar yang bersih, polipropilen atau baja tahan karat mungkin lebih disukai.

Permukaan kerja harus tahan bahan kimia, halus, dan mudah dibersihkan. Area kerja bangku harus memiliki ruang lutut untuk memungkinkan kursi di dekat instrumen tetap atau untuk prosedur yang membutuhkan operasi lama.

Area kerja, termasuk komputer, harus menggabungkan fitur ergonomis, seperti penyesuaian, pencahayaan tugas, dan tata letak peralatan yang nyaman. Berikan ruang yang cukup untuk ventilasi dan pendinginan komputer dan elektronik lainnya.

Wastafel cuci tangan untuk bahan yang sangat berbahaya mungkin memerlukan kontrol siku, kaki, atau elektronik. Jangan memasang cupinks lebih dari yang dibutuhkan. Wastafel yang tidak digunakan dapat mengembangkan jebakan kering yang menyebabkan keluhan bau.

9.B.5.3. Ruang Bersama

Banyak fasilitas mendorong berbagi beberapa peralatan. Menempatkan peralatan di ruang yang tidak didefinisikan sebagai bagian dari zona kerja individu memfasilitasi berbagi. Beberapa contoh peralatan yang dapat digunakan bersama ada pada Tabel 9.2.

TABEL 9.2

Contoh Peralatan Yang Dapat Dibagikan Antara Peneliti dan Kelompok Penelitian.

Dalam pengaturan laboratorium terbuka, duplikasi banyak peralatan ini dapat dihindari. Seringkali, jika peralatan terletak di dekat laboratorium, peralatan tersebut dapat ditutup untuk mengurangi kebisingan.

Tim perlu hati-hati menangani kebutuhan akan alarm pada peralatan tertentu seperti freezer dan inkubator yang berisi sampel berharga.

Namun, harus hati-hati agar tidak berasumsi bahwa berbagi selalu efektif. Ada peralatan tertentu yang harus didedikasikan untuk pengguna tertentu.

9.B.5.4. Lantai

Laboratorium basah harus memiliki lantai tertutup yang tahan bahan kimia. Barang lembaran biasanya lebih disukai daripada ubin lantai, karena ubin lantai dapat mengendur atau rusak seiring waktu, terutama di dekat tudung dan bak cuci bahan kimia laboratorium. Bahan karet atau lantai dengan sedikit pasir mungkin lebih tahan slip, yang diinginkan di laboratorium kimia. Lantai berlapis yang memungkinkan 4 sampai 8 inci bahan lantai yang diamankan ke dinding untuk membentuk dasar dinding juga diinginkan.

Lantai di atas area dengan peralatan sensitif, seperti laser, harus disegel untuk mencegah kebocoran.

9.B.5.5. Pintu, Jendela, dan Dinding

Dinding harus difinishing dengan bahan yang mudah dibersihkan dan dirawat. Kode api mungkin memerlukan pintu, bingkai, dan dinding tertentu untuk diberi peringkat api.

Pintu harus memiliki panel pandang untuk mencegah kecelakaan yang disebabkan oleh membuka pintu ke seseorang di sisi lain dan untuk memungkinkan individu melihat ke dalam laboratorium jika terjadi kecelakaan atau cedera. Pintu harus terbuka ke arah jalan keluar.

Laboratorium tidak boleh memiliki jendela yang dapat dioperasikan, terutama jika ada tudung kimia atau sistem ventilasi lokal lainnya di lab.

9.B.6. Masalah Kebisingan dan Getaran

Banyak laboratorium menggunakan peralatan yang dapat mengeluarkan suara bising yang signifikan, memerlukan lingkungan struktural yang stabil, atau keduanya. Selama tahap perencanaan awal, semua peralatan harus didiskusikan mengenai kebisingan yang unik atau sensitivitas getaran untuk menemukan peralatan dengan benar.

Peralatan besar seperti sentrifugal, shaker, dan penangas air sering kali berfungsi paling baik di ruang peralatan terpisah. Pompa untuk unit spektrometer massa yang lebih tua panas dan berisik dan sering ditempatkan di ruangan kecil atau aula. Jika di dalam lemari, area tersebut harus memiliki knalpot ekstra untuk menghilangkan panas, atau peralatan mungkin gagal karena terlalu panas. Dengan spektrometer massa yang lebih kecil dan lebih baru, pompa seringkali berukuran kecil dan dapat masuk ke dalam lemari yang dirancang khusus untuknya. Pompa ini bekerja sangat baik ketika pendinginan air tidak diperlukan. Sangat sedikit peneliti yang perlu mendengar instrumentasi mereka berjalan, tetapi banyak yang ingin melihat peralatannya.

Pertimbangan lain yang penting untuk area padat peralatan adalah toleransi getaran yang diizinkan. Sebagian besar peralatan analitis seperti NMR, mikroskop sensitif, spektrometer massa, dan peralatan yang menggunakan amplifikasi cahaya (laser) memerlukan tabel isolasi getaran atau area yang dirancang secara struktural untuk memungkinkan getaran yang sangat sedikit. Perjelas persyaratan toleransi dengan pengguna dan produsen peralatan selama fase pemrograman peralatan, atau proses desain awal, sehingga struktur yang sesuai dapat dirancang dan biaya konstruksi dapat diperkirakan lebih akurat.

9.B.7. Peralatan dan Utilitas Keselamatan

Setiap laboratorium harus memiliki jumlah dan penempatan pancuran keselamatan, unit pencuci mata, dan alat pemadam kebakaran yang memadai untuk operasinya. (Lihat Bab 6, bagian 6.C.10, untuk informasi lebih lanjut.) Standar American National Standards Institute (ANSI) Z358.1-2004 memberikan panduan untuk pemasangan pancuran dan pencuci mata yang aman. Versi 2004 merekomendasikan penyediaan air hangat, yang dapat menjadi rumit dari sudut pandang teknik. Meskipun standar ini tidak membahas air limbah, sebagian besar perancang setuju bahwa unit pencuci mata dan pancuran darurat harus dihubungkan ke pipa pembuangan. Adalah bijaksana untuk memiliki saluran pembuangan lantai di dekat unit, sebaiknya miring ke saluran pembuangan untuk mencegah banjir yang berlebihan dan potensi bahaya tergelincir. Pertimbangkan untuk memilih pancuran keselamatan bebas penghalang dan unit pencuci mata yang dapat mengakomodasi individu penyandang disabilitas. Ketinggian jangkauan maksimum untuk kontrol aktivasi untuk pancuran keselamatan adalah 48 inci.

Sistem sprinkler mungkin diperlukan oleh kode bangunan dan hampir selalu direkomendasikan. Untuk area dengan peralatan atau bahan yang sensitif terhadap air, pertimbangkan sistem preaction. Kebanyakan sistem kering atau alternatif tidak berfungsi di lingkungan laboratorium dengan tudung kimia dan ventilasi lainnya. Mungkin ada penolakan terhadap gagasan memasang sistem sprinkler di laboratorium, terutama laboratorium yang menggunakan bahan kimia atau peralatan yang peka terhadap air. Fakta-fakta berikut mungkin berguna:

9.B.8. Undang-Undang Penyandang Disabilitas Amerika: Masalah Aksesibilitas Dalam Laboratorium

Judul 1 Undang-Undang Penyandang Disabilitas Amerika (ADA) tahun 1990 mewajibkan pemberi kerja untuk menyediakan akomodasi yang wajar bagi individu penyandang disabilitas yang memenuhi syarat yang merupakan karyawan atau pelamar pekerjaan, kecuali jika hal itu akan menyebabkan kesulitan yang tidak semestinya. Tim desain dan pemilik bertanggung jawab untuk mengidentifikasi akomodasi yang wajar yang harus dan dapat dibuat untuk memenuhi pedoman atau persyaratan ADA.

Selain itu, beberapa sistem sekolah dan kotamadya memerlukan jumlah atau persentase minimum area kerja yang dapat diakses di laboratorium pengajaran. Furnitur yang mudah diakses, termasuk tudung kimia laboratorium, sudah tersedia dari sebagian besar pemasok. American Chemical Society memiliki sumber daya yang sangat baik yang tersedia secara online atau cetak, Mengajar Kimia untuk Siswa Penyandang Disabilitas: Panduan untuk Sekolah Menengah Atas, Perguruan Tinggi, dan Program Pascasarjana (ACS, 2001).

Adalah bijaksana untuk menyediakan pancuran keselamatan bebas hambatan dan unit pencuci mata untuk semua laboratorium. Gambar 9.2 mengilustrasikan spesifikasi peralatan darurat bebas hambatan, menurut ANSI 117.1-1992, �silitas Bangunan yang Dapat Diakses dan Dapat Digunakan.”

GAMBAR 9.2

Spesifikasi untuk pancuran pengaman bebas penghalang dan unit pencuci mata.

Akomodasi tambahan mungkin perlu dibuat secara individual, tergantung pada kebutuhan khusus peneliti. Bermitra dengan peneliti, supervisor, dan profesional keselamatan laboratorium akan membantu menentukan sejauh mana akomodasi.

Untuk laboratorium basah, hewan penolong harus memiliki tempat di luar lab atau area di dalam laboratorium yang dapat diakses tanpa hewan harus melintasi area di mana bahan kimia atau bahan berbahaya lainnya dapat berada di lantai, termasuk tumpahan.

9.B.9. Fasilitas Lama

Fasilitas penuaan dapat menghadirkan banyak tantangan. Ketika bahan konstruksi mulai menurun, ketentuan keselamatan dan lingkungan dari fasilitas sering kali juga menurun. Meskipun beberapa peralatan dan bahan dapat terus berfungsi dengan baik selama bertahun-tahun, alternatif modern mungkin menawarkan fitur keselamatan dan kelestarian lingkungan yang lebih baik.

Untuk fasilitas yang lebih tua, penting untuk memiliki program operasi dan pemeliharaan yang kuat yang memantau dan memelihara pipa ledeng, ventilasi, dan komponen struktural. Meskipun demikian, karena laboratorium atau ruang individu direnovasi untuk penggunaan baru atau peningkatan, ada peluang untuk meningkatkan dan memodernisasi sistem bangunan.

Bergantung pada lokasi gedung laboratorium, mungkin ada persyaratan untuk membawa seluruh gedung ke kode dan standar gedung saat ini setelah persentase tertentu dari gedung sedang direnovasi. Persyaratan kode ini dapat mencakup sistem proteksi kebakaran, aksesibilitas, pipa ledeng, ventilasi, sistem alarm, pembatasan penyimpanan bahan kimia, dan masalah jalan keluar.

Dengan meningkatnya minat dalam konservasi energi, ada banyak penelitian dan contoh retro-commissioning laboratorium. Fokusnya umumnya pada sistem ventilasi laboratorium, dengan tujuan mengelola aliran udara dan kontrol suhu untuk menghilangkan limbah dan mengurangi penggunaan energi secara keseluruhan. Dalam “Laboratories for the 21st Century” Badan Perlindungan Lingkungan AS (EPA/DOE, 2006), melaporkan bahwa dalam kebanyakan kasus yang diteliti, retro-commissioning, bila direncanakan dan dilaksanakan dengan baik, menghasilkan pengurangan setidaknya 30% dari keseluruhan penggunaan energi fasilitas dengan jangka waktu pengembalian kurang dari 3 tahun.

Proses retro-commissioning yang khas berlangsung dalam lima langkah utama:

Kondisi umum yang menyebabkan pemborosan energi meliputi:

Apakah retro-commissioning untuk efisiensi energi atau untuk keselamatan, pastikan bahwa semua pemangku kepentingan terlibat dalam proses tersebut. Setelah pekerjaan selesai, terus pantau efisiensi dan keamanan. Penting untuk menyertakan personel laboratorium terlatih dalam proses umpan balik. Jika sistem tidak digunakan dengan benar atau jika dilewati, efisiensi retro-commissioning dapat menurun.


  • Sel-sel yang akan dipelajari perlu dikumpulkan.
  • Memecah membran sel terbuka untuk mengekspos DNA bersama dengan sitoplasma di dalam (lisis sel).
    • Lipid dari membran sel dan nukleus dipecah dengan deterjen dan surfaktan.
    • Memecah protein dengan menambahkan protease (opsional).
    • Memecah RNA dengan menambahkan RNase (opsional).
      biasanya dengan etanol dingin atau isopropanol. Karena DNA tidak larut dalam alkohol ini, DNA akan beragregasi bersama, memberikan pelet pada sentrifugasi. Pengendapan DNA ditingkatkan dengan meningkatkan kekuatan ionik, biasanya dengan menambahkan natrium asetat. di mana fenoldenaturasi protein dalam sampel. Setelah sentrifugasi sampel, protein terdenaturasi tetap berada dalam fase organik sedangkan fase berair yang mengandung asam nukleat dicampur dengan kloroform untuk menghilangkan residu fenol dari larutan. yang bergantung pada fakta bahwa asam nukleat dapat mengikat (adsorpsi) ke fase padat (silika atau lainnya) tergantung pada pH dan konsentrasi garam buffer.
  • Protein seluler dan histon yang terikat pada DNA dapat dihilangkan baik dengan menambahkan protease atau dengan mengendapkan protein dengan natrium atau amonium asetat, atau mengekstraknya dengan campuran fenol-kloroform sebelum pengendapan DNA.

    Setelah isolasi, DNA dilarutkan dalam buffer yang sedikit basa, biasanya dalam buffer TE, atau dalam air yang sangat murni.

    Beberapa metode ekstraksi DNA yang paling umum termasuk ekstraksi organik, ekstraksi Chelex, dan ekstraksi fase padat. [3] Metode-metode ini secara konsisten menghasilkan DNA yang diisolasi, tetapi keduanya berbeda dalam kualitas dan kuantitas DNA yang dihasilkan. Saat memilih metode ekstraksi DNA, ada beberapa faktor yang perlu dipertimbangkan, termasuk biaya, waktu, keamanan, dan risiko kontaminasi.

    Ekstraksi organik melibatkan penambahan dan inkubasi dalam beberapa larutan kimia yang berbeda [3] termasuk langkah lisis, ekstraksi kloroform fenol, pengendapan etanol, dan langkah pencucian. Ekstraksi organik sering digunakan di laboratorium karena murah, dan menghasilkan DNA murni dalam jumlah besar. Meskipun mudah, ada banyak langkah yang terlibat, dan butuh waktu lebih lama daripada metode lain. Ini juga melibatkan penggunaan bahan kimia beracun fenol dan kloroform yang tidak menguntungkan, dan ada peningkatan risiko kontaminasi karena pemindahan DNA antara beberapa tabung. [4] Beberapa protokol berdasarkan ekstraksi organik DNA secara efektif dikembangkan beberapa dekade yang lalu, [5] meskipun versi yang lebih baik dan lebih praktis dari protokol ini juga telah dikembangkan dan diterbitkan dalam beberapa tahun terakhir. [6]

    Metode ekstraksi Chelex melibatkan penambahan resin Chelex ke sampel, merebus larutan, kemudian divortex dan disentrifugasi. Bahan seluler mengikat manik-manik Chelex, sedangkan DNA tersedia di supernatan. [4] Metode Chelex jauh lebih cepat dan sederhana daripada ekstraksi organik, dan hanya membutuhkan satu tabung, yang mengurangi risiko kontaminasi DNA. Sayangnya, ekstraksi Chelex tidak menghasilkan jumlah yang banyak dan DNA yang dihasilkan adalah untai tunggal, yang berarti hanya dapat digunakan untuk analisis berbasis PCR dan tidak untuk RFLP. [4]

    Ekstraksi fase padat seperti menggunakan metode ekstraksi berbasis kolom spin mengambil keuntungan dari fakta bahwa DNA mengikat silika. Sampel yang mengandung DNA ditambahkan ke kolom yang berisi gel silika atau manik-manik silika dan garam chaotropic. Garam chaotropic mengganggu ikatan hidrogen antara untai dan memfasilitasi pengikatan DNA ke silika dengan menyebabkan asam nukleat menjadi hidrofobik. Ini memperlihatkan residu fosfat sehingga tersedia untuk adsorpsi. [7] DNA mengikat silika, sedangkan sisa larutan dicuci menggunakan etanol untuk menghilangkan garam chaotropic dan konstituen lain yang tidak perlu. [3] DNA kemudian dapat direhidrasi dengan larutan air rendah garam yang memungkinkan elusi DNA dari manik-manik.

    Metode ini menghasilkan DNA untai ganda berkualitas tinggi yang dapat digunakan untuk analisis PCR dan RFLP. This procedure can be automated [4] and has a high throughput, although lower than the phenol-chloroform method. This is a one-step method i.e the entire procedure is completed in one tube. This lowers the risk of contamination making it very useful for forensic extraction of DNA. Multiple solid phase extraction commercial kits are manufactured and marketed by different companies the only problem is that they are more expensive than organic extraction or Chelex extraction.

    Specific techniques must be chosen for isolation of DNA from some samples. Typical samples with complicated DNA isolation are:

    • archaeological samples containing partially degraded DNA, see ancient DNA[8]
    • samples containing inhibitors of subsequent analysis procedures, most notably inhibitors of PCR, such as humic acid from soil, indigo and other fabric dyes or haemoglobin in blood
    • samples from microorganisms with thick cellular wall, for example yeast
    • samples containing mixed DNA from multiple sources

    Extrachromosomal DNA is generally easy to isolate, especially plasmids may be easily isolated by cell lysis followed by precipitation of proteins, which traps chromosomal DNA in insoluble fraction and after centrifugation, plasmid DNA can be purified from soluble fraction.

    A Hirt DNA Extraction is an isolation of all extrachromosomal DNA in a mammalian cell. The Hirt extraction process gets rid of the high molecular weight nuclear DNA, leaving only low molecular weight mitochondrial DNA and any viral episomes present in the cell.

    A diphenylamine (DPA) indicator will confirm the presence of DNA. This procedure involves chemical hydrolysis of DNA: when heated (e.g. ≥95 °C) in acid, the reaction requires a deoxyribose sugar and therefore is specific for DNA. Under these conditions, the 2-deoxyribose is converted to w-hydroxylevulinyl aldehyde, which reacts with the compound, diphenylamine, to produce a blue-colored compound. DNA concentration can be determined measuring the intensity of absorbance of the solution at the 600 nm with a spectrophotometer and comparing to a standard curve of known DNA concentrations.

    Measuring the intensity of absorbance of the DNA solution at wavelengths 260 nm and 280 nm is used as a measure of DNA purity. DNA can be quantified by cutting the DNA with a restriction enzyme, running it on an agarose gel, staining with ethidium bromide (EtBr) or a different stain and comparing the intensity of the DNA with a DNA marker of known concentration.

    Using the Southern blot technique, this quantified DNA can be isolated and examined further using PCR and RFLP analysis. These procedures allow differentiation of the repeated sequences within the genome. It is these techniques which forensic scientists use for comparison, identification, and analysis.

    In this method, plant nuclei are isolated by physically grinding tissues and reconstituting the intact nuclei in a unique Nuclear Isolation Buffer (NIB). The plastid DNAs are released from organelles and eliminated with an osmotic buffer by washing and centrifugation. The purified nuclei are then lysed and further cleaned by organic extraction, and the genomic DNA is precipitated with a high concentration of CTAB. The highly pure, high molecular weight gDNA is extracted from the nuclei, dissolved in a high pH buffer, allowing for stable long-term storage. [9]


    Handling and Storing Chemicals

    Let&rsquos face it: most laboratories use chemicals. Depending on the lab&rsquos focus&mdashresearch synthesis, compound production, basic acid digestions, etc.&mdashthe types and amounts of chemicals used can vary greatly. Unfortunately, reports of accidents and incidents involving the use and storage of chemicals are far too frequent. We must remain diligent in properly handling and storing these hazardous materials, or problems will arise. So, in this column we provide general safety rules of thumb for handling and storing chemicals in the laboratory.

    Before we get into the details, it is important to take stock of the many federal, state, and local regulations that may include specific requirements for handling and storing chemicals in labs and stockrooms. For example, controlled substances and consumable alcohols are regulated by the Food and Drug Administration and the Drug Enforcement Agency, radioactive substances are regulated by the Nuclear Regulatory Commission, and hazardous wastes are governed by the Environmental Protection Agency. These specific requirements can range from simple locked storage cabinets and specific waste containers to controlled access for regulated areas. If any of your labs are using or generating potentially hazardous substances, determine which regulations apply and the specific requirements they impose. State or local building and fire codes are very common, and applicability is becoming more demanding each year.

    Another hurdle frequently encountered is the fact that labs evolve and change over time. We need to focus awareness on our lab facilities and implement a regular (annual) review process to ensure our overall laboratory safety stays up to date.

    First&mdashThe right personal protective equipment (PPE)

    The focus of this article is safe storage of chemicals. But before we start rounding up bottles of chemicals and reorganizing our labs, we need to make sure we have the proper PPE. At a minimum, this should include appropriate chemical-resistant gloves and eye protection, closed-toe shoes (essential for working in the laboratory), and lab coats and/or chemical aprons (used when needed or when required by your laboratory safety policy).

    Once we have collected our PPE, there are just a couple more things to gather before we begin moving those chemical containers around. Survey your surroundings, and take notice of any potential trip hazards and locations of work stations where others are busy. Make sure exits, passageways, and emergency equipment areas (i.e., eyewash and safety showers) are clear and free of stored materials. Locate and have close at hand a full spill kit with appropriate absorbent materials, neutralizing agents, cleanup utensils, and waste containers. Finally, check that all chemical containers have complete labels in good condition and that safety data sheets (SDS) are readily available. Consult OSHA&rsquos Hazard Communication Standard 1 for guidance. Another good resource for this is the Standard System for the Identification of the Hazards of Materials for Emergency Response. 2

    Next&mdashSafe transport

    Here are our pointers for moving chemicals safely:

      Never move visibly degrading chemicals and containers. Report these to your lab supervisor or principle investigator.

    Rules for chemical storage

    Safely storing chemicals in a laboratory or stockroom requires diligence and careful consideration. Correct use of containers and common lab equipment is critical. To store chemicals safely, DO the following

      Label all chemical containers fully. We recommend including the owner&rsquos or user&rsquos name along with the date received.

    And AVOID doing the following:

      Storing large, heavy containers or liquids on high shelves or in high cabinets. Instead store these at shoulder level or below.

    Following these simple guidelines will get you well on the way to an efficient, organized, and safely operating laboratory. Ignore them, or become cavalier in their application, and you may be picking through ashes or rubble one day. Spend a few minutes going through the lab with this list on a regular basis, and you should avoid any major incidents with chemical storage. As always, safety first.


    Keys for safe chemical storage:

    • Ensure all containers of hazardous chemicals are properly labeled with the identity of the hazardous chemical(s) and appropriate hazard warnings.
    • Segregate all incompatible chemicals for proper storage of chemicals by hazard class. In other words, store like chemicals together and away from other groups of chemicals that might cause reactions if mixed.
    • Do not store chemicals alphabetically except within a grouping of compatible chemicals.
    • Flammable materials should be stored in an approved, dedicated flammable materials storage cabinet or storage room if the volume exceeds ten gallons. Keep cabinet doors closed. See this page for much more information and grounding requirements.
    • Chemicals should be stored no higher than eye level and never on the top shelf of a storage unit. Do not overcrowd shelves. Each shelf should have an anti-roll lip.
    • Avoid storing chemicals on the floor (even temporarily) or extending into traffic aisles.
    • Liquids should be stored in unbreakable or double-contained packaging, or the storage cabinet should have the capacity to hold the contents if the container breaks.
    • Store acids in a dedicated acid cabinet. Nitric acid may be stored there also but only if it is kept isolated from all other acids.
    • Store highly toxic or controlled materials in a locked, dedicated poison cabinet.
    • Volatile or highly odorous chemical shall be stored in a ventilated cabinet. Chemical fume hoods shall not be used for storage as containers block proper air flow in the hood and reduce available work space.
    • All chemicals should be labeled and dated upon receipt in the lab and on opening. This is especially important for peroxide-forming chemicals such as ethers, dioxane, isopropanol, and tetrahydrofuran. Solutions should be labeled and dated when prepared.
    • Look for unusual conditions in chemical storage areas, such as:
    • Improper storage of chemicals
    • Leaking or deteriorating containers
    • Spilled chemicals
    • Temperature extremes (too hot or cold in storage area)
    • Lack of or low lighting levels
    • Blocked exits or aisles
    • Doors blocked open, lack of security
    • Trash accumulation
    • Open lights or matches
    • Fire equipment blocked, broken or missing
    • Lack of information or warning signs ("Flammable liquids", "Acids", "Corrosives", "Poisons", etc.)
    • First aid supplies, emergency phone numbers, eyewash and emergency shower equipment, fire extinguishers, spill cleanup supplies and personal protective equipment should be readily available and personnel trained in their use.
    • Chemicals stored in explosion-proof refrigerators or cold rooms shall be sealed and labeled with the name of the person who stored the material in addition to all other required hazard warnings.
    • Only compressed gas cylinders that are in use and secured in place shall be kept in the laboratory. All others, including empties, shall be sent to the compressed gas cylinder storage area for the particular facility.
    • Keep all stored chemicals, especially flammable liquids, away from heat and direct sunlight.

    Regulation of H+ by the Lungs

    Acid–base imbalances in the blood’s pH can be altered by changes in breathing to expel more CO2 and raise pH back to normal.

    Tujuan pembelajaran

    Describe the regulation of hydrogen ions by the lungs

    Takeaways Kunci

    Poin Kunci

    • Hydrogen ions (H+) are carried in the blood along with oxygen and carbon dioxide.
    • Sixty percent of the carbon dioxide is carried as dissolved bicarbonate.
    • A small amount of carbon dioxide is carried on the hemoglobin as carbaminohemoglobin, which is transported to the lungs for removal.
    • Following Le Chatelier’s principle, an imbalance in pH is returned to normal by increasing the rate of ventilation in the lungs.
    • To compensate for acidemia, more CO2 is expelled, while the opposite occurs for alkalemia.

    Istilah Utama

    • karbaminohemoglobin: A compound of hemoglobin and carbon dioxide. It is one of the forms in which carbon dioxide exists in the blood.
    • Le Chatelier’s principle: A principle that states that if a chemical system at equilibrium experiences a change in concentration, temperature, or total pressure, the equilibrium will shift in order to minimize that change.

    Contoh

    Since maintaining normal pH is vital for life, and since the lungs play a critical role in maintaining normal pH, smokers have yet another reason to quit smoking.

    Acid–base imbalance occurs when a significant insult causes the blood pH to shift out of its normal range (7.35 to 7.45). An excess of acid in the blood is called acidemia and an excess of base is called alkalemia.

    The process that causes the imbalance is classified based on the etiology of the disturbance (respiratory or metabolic) and the direction of change in pH ( acidosis or alkalosis). There are four basic processes and one or a combination may occur at any given time.

    1. Asidosis metabolik
    2. Asidosis respiratorik
    3. Alkalosis metabolik
    4. Alkalosis respiratorik

    Blood carries oxygen, carbon dioxide, and hydrogen ions (H+) between tissues and the lungs. The majority of CO2 transported in the blood is dissolved in plasma (60% is dissolved bicarbonate).

    Expiration: When blood pH drops too low, the body compensates by increasing breathing to expel more carbon dioxide.

    A smaller fraction is transported in the red blood cells that combine with the globin portion of hemoglobin as carbaminohemoglobin. This is the chemical portion of the red blood cell that aids in the transport of oxygen and nutrients around the body, but, this time, it is carbon dioxide that is transported back to the lung.

    Acid–base imbalances that overcome the buffer system can be compensated in the short term by changing the rate of ventilation. This alters the concentration of carbon dioxide in the blood, shifting the above reaction according to Le Chatelier’s principle, which in turn alters the pH. The basic reaction governed by this principle is as follows:

    When the blood pH drops too low (acidemia), the body compensates by increasing breathing to expel more CO2 this shifts the above reaction to the left such that less hydrogen ions are free thus, the pH will rise back to normal. For alkalemia, the opposite occurs.


    Langkah 1. Membuka sel untuk melepaskan DNA

    Sel-sel dalam sampel dipisahkan satu sama lain, seringkali dengan cara fisik seperti penggilingan atau vortexing, dan dimasukkan ke dalam larutan yang mengandung garam. Ion natrium bermuatan positif dalam garam membantu melindungi gugus fosfat bermuatan negatif yang berjalan di sepanjang tulang punggung DNA.

    Kemudian ditambahkan detergen. Deterjen memecah lipid dalam membran sel dan inti. DNA dilepaskan saat membran ini terganggu.

    Langkah 2. Memisahkan DNA dari protein dan puing-puing seluler lainnya

    Untuk mendapatkan sampel DNA yang bersih, perlu untuk menghilangkan sebanyak mungkin puing-puing seluler. Ini dapat dilakukan dengan berbagai metode. Seringkali protease ( enzim protein) ditambahkan untuk mendegradasi protein terkait DNA dan protein seluler lainnya. Atau, beberapa puing seluler dapat dihilangkan dengan menyaring sampel.

    Langkah 3. Pengendapan DNA dengan alkohol

    Akhirnya, alkohol dingin (baik etanol atau isopropanol) ditambahkan dengan hati-hati ke sampel DNA. DNA larut dalam air tetapi tidak larut dengan adanya garam dan alkohol. Dengan mengaduk lapisan alkohol secara perlahan dengan pipet steril, endapan menjadi terlihat dan dapat keluar. Jika ada banyak DNA, Anda mungkin melihat endapan putih berserabut.

    Langkah 4. Membersihkan DNA

    Sampel DNA sekarang dapat dimurnikan lebih lanjut (dibersihkan). Kemudian disuspensikan kembali dalam buffer yang sedikit basa dan siap digunakan.

    Langkah 5. Mengonfirmasi keberadaan dan kualitas DNA

    Untuk pekerjaan laboratorium lebih lanjut, penting untuk mengetahui konsentrasi dan kualitas DNA.

    Pembacaan kerapatan optik yang diambil oleh spektrofotometer dapat digunakan untuk menentukan konsentrasi dan kemurnian DNA dalam sampel. Atau, elektroforesis gel dapat digunakan untuk menunjukkan keberadaan DNA dalam sampel Anda dan memberikan indikasi kualitasnya.


    Extended Data Fig. 1 HF treatment on RNA and peptides.

    A, Schematic illustration of HF treatment on RNA (left) and the resulting products (right). HF-mediated cleavage sites are highlighted. B, UV-absorbance chromatogram of 20-mer RNA (AUGCAUGCAUGCAUGCAUGC) digested with HF (black solid and dashed lines from duplicate experiments), merged with those of undigested RNA (gray) and reference chemicals (colored, solid). Peaks of reference chemicals were re-sized for better visualization. The black solid line is the source data for Fig. 1b. C, UV-absorbance chromatogram of HeLaT total RNA digested with HF (black, solid or dashed lines from duplicate experiments), merged with those of reference chemicals (colored, solid). Peaks of reference chemicals were re-sized for better visualization. D, Proportion of semi-tryptic PSM identified from HeLaT digest peptides upon HF treatment, compared to negative control treated with H2O. Two-sided unpaired Student’s T-test was performed between n = 3 biologically independent samples (H2O vs. HF), assuming equal variance. The mean values were depicted with error bars that indicate standard deviation between replicates. P-value, rounded up to the fourth decimal point: 0.0258. e, Proportion of identified PSM (below PSM-level FDR = 0.01) upon HF treatment, compared to H2O treatment. Two-sided unpaired Student’s T-test was performed as described above. The mean values were depicted with error bars that indicate standard deviation between replicates. P-value, rounded up to the fourth decimal point: 0.1359.

    Extended Data Fig. 2 Open search on total RNA-RBS and mRNA-RBS using MODa and MSFragger.

    A, MODa 14 search for modified mass on mRNA-RBS. The y-axis indicates mean spectral counts from duplicate experiments. B-C, MSFragger 15 search for modified mass on total RNA-RBS (B) and mRNA-RBS (C). D, Mean percentage of Uracil modification over Uridine modification, a highly likely in-source fragmentation product, between replicate experiments, calculated from MSFragger search results as (#PSM with Uracil adduct: 112 & 55 to account for Cys)/(#PSM with Uracil or Uridine adduct: 244, 112 & 187, 55 to account for Cys). The error bars indicate standard deviation. Free Cys was carbamidomethylated, so the corresponding adduct mass was used as a fixed modification. Owing to mutually exclusive U-crosslinking and carbamidomethylation on Cys, the observed conjugate mass of uridine on Cys (187) was smaller than that of other amino acids (244) by the difference of mass of carbamidomethyl group (57). Thus, modification mass on Cys was corrected by adding the mass of carbamidomethyl group. The percentages were rounded up to the second decimal point. e, Comparison of closed search results on total RNA and mRNA RBS-ID experiments, allowing up to one or two modifications per peptide. Modification-specific peptide-level FDR was set to 0.01. PSM counts for peptides with two modifications were depicted.

    Extended Data Fig. 3 Comparison between RBS-ID and previous RBS- or RBD-profiling studies.

    A, Comparison of the position of RBS in peptides shared between RBS-ID and RNP xl Venn diagram (left) shows the overlap between the peptides with uniquely localized RBS in RBS-ID (1,972) and those in human proteins of RNP xl (29) 6 . Please note that most peptides from RNP xl are also detected by RBS-ID, demonstrating the comprehensiveness of our method. The Pie chart (right) displays that among 25 common peptides, 24 peptides show consistent localization of RBS between the datasets, indicating the accuracy of the methods. B, Relative position of the peptides identified as ‘RBDpep’ 4 . X-axis shows the position of the terminus of peptides relative to RBSs identified by RBS-ID (n = 1,478). C, Relative position of the peptides identified as ‘XL-peptide’ 7 . X-axis shows the position of the terminus of peptides relative to RBSs identified by RBS-ID (n = 869).

    Extended Data Fig. 4 Reproducibility of MS1 intensity-based label-free quantification.

    A-B, MS1 intensity-based label-free quantification 27 of RBS-containing peptides co-identified in Total RNA-RBS (A) or mRNA-RBS (B) replicate experiments. Pearson’s correlation coefficient and Spearman’s correlation coefficient were each calculated and rounded up to the second decimal point.

    Extended Data Fig. 5 RBS-identified protein groups and regions.

    A, Top 5 GO terms associated with proteins that are not annotated as RBPs (MF: molecular function, BP: biological process, CC: Cellular component, 5 each) 20,21 . B-C, Top 5 GO terms associated with proteins whose RBSs are identified exclusively in total RNA enrichment but not in poly(A) + RNA enrichment (B) or in poly(A) + RNA enrichment but not in total RNA enrichment (C) (MF, BP, CC, 5 each).

    Extended Data Fig. 6 Examples of RBS-identified proteins.

    A, Example of RBSs identified in distant primary sequence positions (PABPC1). Sequence homology of amino acids at -5 to +5 positions from Y194, Y297, and Y364 compared to that of Y222, F325, and Y393 in yeast Pab1 are described, respectively. Identical amino acids in the same positions are bold-faced. B, Partial structure of yeast Pab1 bound to poly(A) RNA (PDB 6R5K 22 ). Y222, F325, and Y393 are indicated. C-H, Examples of RBSs identified in regions that are not annotated as RBDs. RBSs identified in NSUN5 (C), RTCA (D), APOBEC3C (e), TRIM25 (F), SERBP1 (G), and HNRNPA1 (H) are depicted. RBSs with high spectral counts are indicated.

    Extended Data Fig. 7 Purified spCas9 protein and template DNA for sgRNA synthesis.

    A, Purified His6-HA-NLS-TEV-spCas9 on SDS-PAGE gel stained with Coomassie G25. B, Template DNA prepared for T7 in vitro transcription of anti-CBX1 sgRNA.

    Extended Data Fig. 8 Positions of RBS in crystal structure of spCas9 in complex with sgRNA and target DNA.

    Positions of RBSs in the crystal structure of spCas9 in complex with sgRNA and target DNA (PDB 4UN3 29 ). Individual atoms of RBSs were drawn as dark blue spheres.

    Extended Data Fig. 9 Impact of RBS mutagenesis on spCas9 gene editing activity.

    A, EtBr-agarose gel image of cut/uncut fragments after T7E1 assay 30 , 48 hours after transfection of negative control (mock), non-target-wildtype (NC), wildtype (WT), Y450A, R919A spCas9. B, EtBr-agarose gel image of input PCR amplicons. C, Histograms of GFP fluorescence of msfGFP-expressing clonal stable 293 cells 96 hours after transfection with non-target-wildtype (NC), wildtype (WT), Y450A, R919A spCas9. D, Cell counts per each flow cytometry run. Uncropped images for panels a-b are available as source data.

    Extended Data Fig. 10 Verification of comparable expression of spCas9.

    A, Verification of comparable expression of spCas9 proteins. Western blot of msfGFP-expressing HEK293E clonal stable cell 48 hours after transfection of negative control (mock), non-target-wildtype (NC), wildtype (WT), Y450A, or R919A spCas9. B, Quantification of spCas9 protein expression level. Two-sided unpaired Student’s T-test was performed with n = 3 biologically independent samples (WT vs. Y450A WT vs. R919A), assuming equal variance. The mean values were depicted with error bars that indicate standard deviation between replicates. P-value, rounded up to the fourth decimal point: 0.3261 (WT vs. Y450A), 0.2257 (WT vs. R919A). Uncropped image for panel a is available as source data.


    Tonton videonya: Praktikum Indikator Asam Basa Alami (Agustus 2022).