Informasi

Infeksi lintas spesies

Infeksi lintas spesies


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Saya pernah mendengar bahwa HIV berkembang dari SIV, dll.

Saya juga mendengar bahwa sebagian besar spesies (termasuk kebanyakan monyet) tidak dapat terkena flu biasa seperti manusia.

Lalu apa yang menyebabkan infeksi dapat menyebar melintasi spesies, atau sebaliknya?

Demi pertanyaan, saya akan mempersempit ruang lingkup. Katakanlah kita memiliki virus yang dapat menginfeksi manusia tetapi tidak menginfeksi kerabat dekat manusia, seperti Simpanse. Bagaimana dengan biologi virus atau biologi hewan yang menyebabkan perbedaan itu?

Saya tahu dengan beberapa hewan ini tentang suhu tubuh atau komposisi kulit, dll. Tapi manusia dan simpanse secara fisik sangat mirip. Apakah ini semua tentang perbedaan kekebalan?


Virus berevolusi bersama inangnya. Jika Anda menukar kromosom manusia ke dalam sel simpanse untuk kromosom simpanse yang cocok, akan ada banyak kesamaan genetik tetapi Anda juga akan memunculkan banyak ketidakcocokan karena gen pada setiap kromosom telah berevolusi secara independen dari genom lainnya.

Virus berinteraksi dengan genom inang mereka pada banyak tahap. Pertama, mereka membutuhkan cara untuk mengidentifikasi inang (sel) target mereka di lingkungan dan mendapatkan akses ke sel. Mereka melakukan ini dengan mengenali penanda pada permukaan sel. Untuk sesuatu seperti HIV, identifikasi ini jauh lebih spesifik daripada hanya mengidentifikasi manusia: mereka mengidentifikasi sel kekebalan tertentu.

Begitu masuk, virus berinteraksi dengan inang untuk mengekspresikan gen virus, memproduksi dan merakit virion baru, dan ditransmisikan ke inang berikutnya. Jika ketidakcocokan terjadi pada salah satu tahap ini, virus tidak akan dapat mereplikasi.

Namun, karena ada banyak homologi antar spesies terkait, virus dapat menginfeksi lebih dari satu inang. Jika virus berkembang dalam konteks di mana biasanya menginfeksi banyak host, mungkin ada tekanan selektif untuk mempertahankan kemampuan tersebut di semua host. Atau, tekanan selektif dapat menyebabkan virus berevolusi menjadi garis keturunan yang terpisah, misalnya satu menginfeksi bebek dan yang lain menginfeksi burung pipit.

Untuk virus yang khusus untuk inang tertentu (atau kisaran inang), kemungkinan akan mengalami kesulitan di inang lain di luar konteks di mana virus itu berevolusi. Namun, ada juga variabilitas dalam genom virus, dan jika banyak salinan virus terpapar ke inang baru, ada kemungkinan beberapa dari mereka dapat bertahan hidup di inang itu. Ini akan memilih untuk gen virus tertentu, dan generasi virus berikutnya akan dipilih lebih lanjut untuk sifat-sifat yang membantu mereplikasi di inang itu.

Reaksi imun juga dapat berperan, tetapi dalam kebanyakan kasus, spesialisasi virus itu sendiri yang memegang kunci kekhususan inang.


Ahlquist, P., Noueiry, A. O., Lee, W. M., Kushner, D. B., & Dye, B. T. (2003). Faktor inang dalam replikasi genom virus RNA untai positif. Jurnal virologi, 77(15), 8181-8186.

Hao, L., Sakurai, A., Watanabe, T., Sorensen, E., Nidom, C. A., Newton, M. A.,… & Kawaoka, Y. (2008). Layar Drosophila RNAi mengidentifikasi gen inang yang penting untuk replikasi virus influenza. Alam, 454(7206), 890.

Schild, G. C., Oxford, J. S., De Jong, J. C., & Webster, R. G. (1983). Bukti untuk pemilihan sel inang varian antigen virus influenza. Alam, 303(5919), 706.


Kunci terbesar untuk memahami virus dan inangnya (lebih spesifik, sel inang) adalah struktur protein eksternal (membran dan ECM).

Sebagai aturan umum, virus perlu menempel pada sel inangnya. Beberapa virus menyalahgunakan mekanisme transportasi untuk mengelabui sel inang agar "memakannya" dan menjalankan isinya. Jenis virus lain memiliki klem yang tampak buruk (contoh paling menonjol yang terlintas dalam pikiran adalah bakteriofag) yang mengambil struktur spesifik pada sel inang sementara bagian tengah virus membuat lubang di membran sel inang untuk memberinya DNA/RNA berbahaya dan enzim.

Infeksi lintas spesies biasanya menyalahgunakan struktur umum untuk banyak spesies. Misalnya, reseptor asam sialat biasanya disalahgunakan sebagai titik masuk virus (lihat https://www.ncbi.nlm.nih.gov/pubmed/23873408). Jika manusia memiliki dukungan genom seperti sistem operasi komputer menerima pembaruan untuk komponen yang rentan, reseptor asam sialat akan diberi label risiko kritis ribuan tahun yang lalu dan ditambal.

Jelas ada faktor lain yang dapat menggagalkan infeksi lintas spesies. Virus lintas spesies yang berhasil perlu menggunakan subset operasi minimum yang didukung dari fungsi sel yang umum bagi inangnya. Jika sel inang potensial (berdasarkan kecocokan struktur eksternal) tidak dapat membuat bagian yang diperlukan untuk replikasi virus, ia gagal. Jika sel inang potensial (atau inang itu sendiri, dalam kasus bentuk kehidupan bersel banyak) dibangun dengan beberapa tindakan anti-infeksi yang aneh (misalnya: deteksi kerusakan, pemeriksaan integritas sebelum memproduksi protein dari RNA, atau kekebalan yang kuat secara tak terduga ), maka infeksi bisa saja gagal.


Spillover: Bagaimana Virus Melompat dari Hewan ke Manusia

Sebuah spillover atau transmisi lintas spesies adalah kemampuan virus asing untuk melompat dari satu spesies ke spesies inang baru, dan menyebar dalam populasi spesies inang baru itu. Perhatikan bahwa penyakit yang disebabkan oleh patogen yang menginfeksi populasi hewan dan manusia umumnya disebut zoonosis. Selain virus, beberapa bakteri, jamur, dan parasit bersifat zoonosis.

Namun, dalam beberapa insiden, setelah patogen melompat dari satu spesies ke spesies lain, ia bermutasi dan menjadi strain baru yang mampu secara efisien dan eksklusif mereplikasi, menyebar, dan berkembang dalam populasi inang baru. Ini adalah definisi utama atau limpahan transmisi lintas spesies.

Beberapa virus terkenal telah melompat dari hewan dan menjadi patogen eksklusif dari populasi manusia. Lebih lanjut, beberapa di antaranya telah menjadi ancaman utama bagi kesehatan masyarakat, sehingga menyebabkan epidemi dan pandemi. Ini termasuk HIV-AIDS, penyakit akibat coronavirus manusia seperti SARS dan MERS, demam Ebola, flu burung atau flu burung, flu babi, dan COVID-2019.


Infeksi lintas spesies mengancam kesehatan manusia dan keanekaragaman hayati

Kredit: Alison Peel

Penyebaran penyakit antar spesies adalah masalah "satu kesehatan" yang mempengaruhi kesehatan manusia dan konservasi satwa liar menurut satu set makalah baru yang diterbitkan hari ini oleh para ilmuwan dari Royal Society dan ZSL.

Edisi khusus Transaksi Filosofis Royal Society B melihat penyebaran penyakit menular, seperti SARS, Flu Burung dan Flu Babi, dari satu spesies ke spesies lain dan bagaimana hal itu tidak hanya menyebabkan masalah bagi manusia tetapi juga mengancam konservasi satwa liar dan kelangsungan hidup populasi yang besar dan kuat.

Makalah tersebut menyatakan bahwa sebagian besar penyakit yang mengancam disebabkan oleh infeksi yang berpindah antar spesies, di mana satu spesies bertindak sebagai reservoir dan kemudian menginfeksi spesies lain yang lebih rentan, yang mungkin menderita tingkat kematian yang tinggi.

Dr Andrew Cunningham dari ZSL menulis bahwa masalah ini membutuhkan solusi trans-disiplin yang holistik. Cara-cara baru untuk mendekati penyelidikan dan pengendalian penyakit dibahas, seperti juga rekomendasi untuk pembuat kebijakan.


Apa Kisaran Inang dan Reservoir Hewan untuk HEV?

Identifikasi genetik terbaru dari strain HEV dari berbagai spesies hewan telah secara signifikan memperluas jangkauan inang dan keragaman genetik virus [4,7]. Selain manusia, HEV telah diidentifikasi secara genetik dari banyak spesies hewan lain termasuk babi liar dan domestik, rusa, kelinci, luwak, ayam, unta, tikus, musang, bandicoot besar, tikus kesturi Asia, cerpelai, rusa besar, dan ikan (Tabel 1 ) [8,9]. Strain HEV hewan yang dicirikan dengan baik termasuk HEV babi genotipe 3 dan 4 dari babi domestik dan liar, HEV kelinci genotipe 3, dan HEV unggas dari ayam. Selain manusia dan babi, strain HEV genotipe 3 juga telah diidentifikasi dari kelinci, rusa, dan luwak. Tikus dan musang masing-masing membawa strain terkait HEV yang secara genetik berbeda dari HEV mamalia dan unggas lainnya (Tabel 1). Gugus HEV rusa dalam spesies Orthohepevirus A membentuk clade yang berbeda dengan nenek moyang yang sama dengan virus genotipe 1𠄶 [9,10]. Virus trout cutthroat menyerupai hepevirus mamalia dalam organisasi genomiknya ( Gambar 1 ) meskipun identitas urutan nukleotida rendah [11] dan mewakili genus yang terpisah Virus Piscihepe. Identifikasi genetik dari berbagai jenis hewan HEV ini memberikan peluang untuk mengembangkan model hewan baru yang terjadi secara alami untuk HEV.

Selain itu, bukti serologis infeksi HEV juga telah dilaporkan pada sejumlah spesies hewan lain, meskipun sumber seropositif pada spesies ini belum diidentifikasi secara genetik. Antibodi anti-HEV dilaporkan terdeteksi pada beberapa spesies ruminansia seperti kambing, sapi, dan domba, serta pada anjing dan kucing tanpa deteksi urutan terkait HEV. Identifikasi genetik definitif dari sumber seropositif HEV pada spesies hewan ini akan mengarah pada penemuan strain hewan baru HEV dan dengan demikian perluasan lebih lanjut dari kisaran inang HEV.


Bahan dan metode

Pernyataan etika

Sampel darah diambil dari subyek manusia, usia 18-70 tahun setelah persetujuan tertulis diperoleh dari semua subyek. Semua protokol eksperimental yang melibatkan sampel manusia telah disetujui oleh Komite Etik Rumah Sakit Universitas Nasional Kangwon (No. IRB 2014-08-008-002), Komite Etika Medis Universitas Malaya (Ref No. 817.18), dan Komite Etik Penelitian Medis ( MREC), Kementerian Kesehatan, Malaysia (Nomor Pendaftaran Riset Medis Nasional No. 13079), sesuai dengan pedoman dan peraturan yang relevan. Sampel darah diambil dari P. pengetahuan-pasien yang terinfeksi dalam tabung EDTA-vacutainer yang disediakan oleh University of Malaya Medical Center (UMMC), Malaysia selama 2010–2013, pada hari ketika pasien didiagnosis positif malaria. Semua P. pengetahuan sampel yang digunakan untuk penelitian ini dikonfirmasi oleh PCR spesifik spesies seperti yang dijelaskan di tempat lain [4]. Serum pasien dikumpulkan dari pasien bergejala yang mengunjungi daerah endemik Malaysia dengan parasitemia rata-rata 0,207% (berkisar dari 0,003 hingga 1,380%) dan rata-rata berusia 38 tahun (berkisar dari 6 hingga 72). Namun, kami tidak memperoleh informasi tentang riwayat infeksi malaria sebelumnya dari pasien. P. vivax-Pasien yang terinfeksi direkrut dari P. vivax-daerah endemik di provinsi Gangwon, Republik Korea (ROK) dimana P. vivax adalah utama Plasmodium spesies, tidak ada P. pengetahuan infeksi di daerah ini [1]. Pasien dengan P. falciparum infeksi dikeluarkan dalam penelitian ini. Serum dikumpulkan dari pasien bergejala yang mengunjungi puskesmas dan klinik setempat di Provinsi Gangwon, ROK dengan parasitemia mulai dari 0,027 hingga 0,630%, rata-rata 0,121%) dan usia 18 hingga 60 tahun (rata-rata 28). P. vivax dan P. pengetahuan delapan sampel serum pasien dikumpulkan setelah PCR spesifik spesies dan delapan individu kesehatan tanpa Plasmodium infeksi. Sebanyak 70 individu P. vivax-, P. pengetahuan-Serum pasien yang terinfeksi dan individu kesehatan digunakan untuk skrining imun individu setelah skrining serum gabungan awal. Pasien tanpa malaria direkrut dari populasi orang sehat yang tinggal di daerah nonendemik malaria ROK yang negatif dikonfirmasi dengan mikroskop dan PCR.

Analisis sekuens identitas asam amino

Antigen target dipilih dari penelitian kami sebelumnya yang terlokalisasi di organel apikal/permukaan merozoit yang berbeda. P. vivax dan dikenali oleh serum pasien manusia (Tabel 1, lihat referensi). Urutan asam amino dari P. vivax (Sal I dan P01 strain) dan P. pengetahuan (Strain H) diambil dari PlasmoDB (www.plasmodb.org) [32] dan disejajarkan. Program cluster W digunakan untuk membuat keselarasan berpasangan untuk menentukan persen identitas asam amino (Tabel 1 dan S1 Gambar).

Kultur in vitro tahap darah P. pengetahuan parasit

Adaptasi manusia P. pengetahuan Strain A1-H.1 dipertahankan dengan eritrosit manusia segar dalam media berbasis RPMI 1640 (Invitrogen/Life Technologies, Grand Island, NY) seperti yang dijelaskan sebelumnya [53].

Ekspresi protein rekombinan

P. vivax protein rekombinan dihasilkan oleh sel benih gandum bebas atau E. coli sistem ekspresi dalam penelitian kami sebelumnya [25,42,44,50]. fragmen DNA encoding PvRBP1a-34, Pv41, atau PvRhopH2 diamplifikasi dari isolat vivax Korea dengan primer PvRBP1a-34_F (ggtcgcggatcc GAATTC ATGAACGAACTAGGTATAGACATT) dan PvRBP1a-34_R (ggtggtggtg ctcgag TTCAAACTCTATCTTCAGTTC) Pv41_F (ggtcgcggatcc GAATTC ATGGAACACATCTGCGATTTTAC) dan Pv41_R (ggtggtggtg ctcgag CTCCTGGAAGGACTTGGCA) dan PvRhopH2_F (ggtcgcggatcc gaattc ATGGAGCTGAGCCACAGC) dan PvRhopH2_R (ggtggtggtg ctcgag CTTCTCCACATCCTCGTGGT), masing-masing. Huruf kecil menunjukkan urutan turunan plasmid dan huruf bergaris bawah masing-masing menunjukkan situs restriksi enzim, EcoRI dan XhoI. Kit KOD-plus high fidelity (Toyobo Co., Osaka, Japan) digunakan dengan langkah denaturasi awal pada 94°C selama 2 menit, diikuti oleh 35 siklus 94°C selama 15 detik, 60°C selama 30 detik, dan 58°C selama 1,5 menit dan tahap perpanjangan akhir pada 68°C selama 10 menit. Amplikon dimurnikan menggunakan kit ekstraksi gel dan diligasi ke dalam vektor ekspresi pET28a(+) (Novagen, Madison, WI) untuk PvRBP1a-34 atau vektor ekspresi pET23a(+) untuk Pv41 dan PvRhopH2 dengan tag-Nya. Plasmid yang diikat dengan benar diubah menjadi E. coli BL21(DE3) pLysS (Life Technologies) untuk ekspresi protein rekombinan. Ekspresi protein rekombinan diinduksi dengan 0,1 mM isopropil-β-D-thiogalactopyranoside (IPTG Sigma-Aldrich, St. Louis, MO). Semua protein rekombinan dilarutkan, dimurnikan, dan dilipat kembali seperti yang dijelaskan di tempat lain [47,54].

Sementara itu, P. pengetahuan protein rekombinan diekspresikan untuk penelitian ini menggunakan sistem bebas sel germinal gandum untuk skrining imun menggunakan primer spesifik (Tabel S2), prosedurnya dijelaskan di tempat lain [47]. Ekspresi protein PkDBPα rekombinan dijelaskan di tempat lain [47]. Fragmen DNA yang mengkode PkRhopH2 diamplifikasi dari P. pengetahuan DNA genom A1-H.1 dengan pasangan primer PkRhopH2_F (ggtcgcggatcc gaattc ATGGAGTTAGGCCATACCGTG) dan PkRhopH2_R (ggtggtggtg ctcgag CTTCTCGATGTCTTCGTAGTCCA). Huruf kecil menunjukkan urutan turunan plasmid dan huruf yang digarisbawahi masing-masing menunjukkan situs restriksi enzim untuk EcoRI dan XhoI. Kit KOD-plus high fidelity digunakan dengan langkah denaturasi awal pada 94°C selama 2 menit, diikuti oleh 35 siklus 94°C selama 15 detik, 60°C selama 30 detik, dan 58°C selama 1,5 menit dan langkah ekstensi akhir pada 68 ° C selama 10 menit. Amplikon dimurnikan menggunakan kit ekstraksi gel dan diligasi ke dalam vektor ekspresi pET28a(+) dengan tag-Nya. Plasmid yang diikat dengan benar diubah menjadi E. coli BL21(DE3). Ekspresi dan pemurnian protein dilakukan seperti yang dijelaskan di atas. P. pengetahuan Protein MSP1-19 diklon ke vektor pGEX-4T-2 (GE Healthcare Life Sciences, Uppsala, Swedia) dengan kloning In-Fusion sesuai dengan manual pabrik, dan pDNA hasil kloning diubah menjadi sel kompeten BL21(DE3) untuk ekspresi protein rekombinan . Protein dimurnikan dengan Glutathione Sepharose 4B (GE Healthcare Life Sciences) dan digunakan untuk produksi antibodi tikus.

SDS-PAGE dan analisis western blot

Parasit lisat dibuat dari P. pengetahuan schizont seperti yang dijelaskan sebelumnya [55]. Protein rekombinan dipisahkan oleh 13% SDS-PAGE dalam kondisi reduksi atau non-reduksi dan diwarnai dengan 0,25% Coomassie briliant biru R-250 (Sigma-Aldrich) dan digunakan untuk analisis western-blotting [25]. Protein yang ditransfer membran direaksikan dengan serum poliklonal kelinci primer (1:50) atau antibodi monoklonal anti-His (1:2.000, Hilden, Hamburg, Jerman) dan kemudian direaksikan dengan anti-kelinci kambing berlabel IRDye sekunder atau anti-kambing -antibodi tikus (1:10.000) (LI-COR Bioscience, Lincoln, NE). Sistem pencitraan inframerah Odyssey (LI-COR Bioscience) dan perangkat lunak Odyssey (LI-COR Bioscience) digunakan untuk memvisualisasikan pita.

Produksi antibodi hewan dan pemurnian IgG

Semua P. vivax antibodi spesifik antigen tahap darah diperoleh selama penelitian kami sebelumnya (Tabel 1, Tabel S3). Total IgG dimurnikan dari 1 mL serum kelinci dengan menggunakan kolom protein G HP sesuai dengan protokol pabrik (GE Healthcare Life Sciences) seperti yang dijelaskan di tempat lain [47]. Semua protokol percobaan hewan telah disetujui oleh Komite Etika Kelembagaan dan mengikuti Pedoman Etis untuk Eksperimen Hewan dari Universitas Nasional Kangwon (KIACUC-16-0158).

Pemurnian antibodi IgG spesifik antigen dari sampel serum pasien

Sampel serum yang digunakan dalam penelitian ini dikumpulkan dari delapan P. vivax-Pasien yang terinfeksi dari ROK dengan respons tinggi terhadap antigen tertentu yang diinginkan, yang diskrining dengan imunoskrining dengan protein microarray. Kontrol terdiri dari sampel serum yang dikumpulkan dari delapan orang sehat dari daerah nonendemik di ROK. Antibodi IgG total dimurnikan dari sampel serum yang dikumpulkan dengan menggunakan kolom protein G sesuai dengan protokol pabrikan (GE Healthcare Life Sciences). Antibodi IgG yang diisolasi didialisis terhadap media RPMI 1640 dan dipekatkan menggunakan perangkat sentrifugal (Merck Millipore, Darmstadt, Jerman) dengan nilai batas 30-kDa hingga konsentrasi 10 hingga 20 mg/mL. Protein rekombinan PvRBP1a, Pv41, dan PvRhopH2 (masing-masing 2-3 mg) diimobilisasi pada manik-manik aliran cepat Sepharose 4 yang diaktifkan sianogen bromida (CNBr) (GE Healthcare Life Sciences) sesuai dengan instruksi pabrik. Antibodi IgG total yang diisolasi (0,5 mL) dimuat ke kolom yang diisi dengan manik-manik yang digabungkan dengan antigen dan dielusi menggunakan buffer elusi (0,1 M glisin, pH 2,7). IgG spesifik antigen yang dielusi segera dinetralkan dengan buffer Tris (pH 9,0) dan didialisis terhadap media RPMI 1640 yang tidak lengkap hingga konsentrasi yang diinginkan.

Uji imunofluoresensi (IFA)

Sebuah IFA dilakukan seperti yang dijelaskan sebelumnya [47]. Slide diperiksa ganda dengan panel serum poliklonal kelinci terhadap P. vivax antigen (1:50) dan serum tikus melawan P. pengetahuan antigen sebagai penanda lokalisasi (PkMSP1-19 untuk permukaan merozoit, PkDBPα-II untuk mikroneme, dan PkRhopH2 untuk rhoptry 1:50). Alexa Fluor 488 kambing anti-tikus IgG (H+L) dan Alexa Fluor 568 kambing-anti kelinci IgG (H+L) digunakan sebagai antibodi sekunder. Nukleus diwarnai dengan 4',6-diamidino-2-phenylindole (DAPI, Invitrogen). Intensitas piksel merah dan hijau dianalisis dengan ImageJ. Plot sebar intensitas piksel merah dan hijau individu kemudian dibandingkan dan koefisien determinasi (R-kuadrat) diperoleh. Yang lebih besar R-kuadrat (mendekati 100%) mewakili nilai sebaran di sekitar garis regresi yang menunjukkan variasi intensitas piksel merah dan hijau di sekitar rata-ratanya. Kolokalisasi ditentukan sebagai tumpang tindih spasial antara intensitas piksel merah (kontrol) dan hijau seperti yang ditunjukkan pada gambar yang lebih besar R-nilai kuadrat.

Mikroarray protein

Protokol microarray protein dijelaskan di tempat lain [25]. Serum dikumpulkan dari delapan P. vivax- dan P. pengetahuan-pasien yang terinfeksi, donor yang sehat dan/atau digunakan secara individu tanpa pengumpulan untuk mengevaluasi aktivitas imun silang. Dikumpulkan atau individu P. vivax- atau P. pengetahuan-serum pasien yang terinfeksi atau serum yang sehat diencerkan sebagai 1:25. Nilai cut-off sama dengan rata-rata intensitas fluoresensi (MFI) ditambah dua standar deviasi (SD) dari sampel negatif. Nilai-nilai LKM yang dinormalisasi dihitung dari nilai-nilai LKM/batas. LKM yang dinormalisasi untuk serum pasien yang dikumpulkan dikurangkan dari LKM yang dinormalisasi yang sesuai untuk serum sehat yang dikumpulkan.

Uji penghambatan pertumbuhan

Protokol standar untuk uji inhibisi invasi telah dijelaskan di tempat lain [47]. Secara singkat, 2 mg/mL antibodi IgG kelinci yang dimurnikan, dan gradien konsentrasi antibodi IgG spesifik antigen dari pasien (0,1, 0,2, dan 0,5 mg/mL) ditambahkan ke pelat kultur 96-sumur yang berisi P. pengetahuan skizon dengan parasitemia awal 1,5% dan hematokrit 2% dari eritrosit manusia segar. Antibodi monoklonal anti-Fy6 (25 g/mL), yang mengenali epitop 2C3 di wilayah DARC N-terminal yang terletak di membran permukaan sel darah merah, diperoleh seperti yang dijelaskan sebelumnya [56]. Antibodi ini merupakan pemberian dari Dr. Olivier Bertrand dan Dr. Yves Colin (Institut National de la Transfusion Sanguine, Paris, Prancis). Setelah 10 jam pasca invasi selama P. pengetahuan, parasit diwarnai dengan SYBR Green I (Sigma-Aldrich) dan dianalisis dengan flow cytometer Accuri C6 (Accuri cytometer Inc., Ann Arbor, MI). Dua percobaan independen dilakukan dalam rangkap tiga percobaan independen dalam rangkap dua tidak mungkin karena jumlah antibodi yang terbatas.

Analisis data

Semua perhitungan dan analisis data dilakukan dengan GraphPad PRISM 5 (GraphPad Software, Inc., San Diego, CA). Uji Mann-Whitney digunakan untuk menilai perbedaan antara rata-rata, dan ANOVA satu arah dengan uji Dunnett digunakan untuk membandingkan rata-rata dari lebih dari dua kelompok dengan kontrol anti-HisGST interval kepercayaan 95% (CI), dan P < 0,05 dianggap signifikan. Konsentrasi penghambatan 50% (IC50) diplot terhadap konsentrasi antibodi yang diubah log, dan penyesuaian kurva dengan regresi nonlinier dengan perangkat lunak Excel digunakan untuk mengidentifikasi penghambatan pertumbuhan parasit 50%. Pengelompokan hirarkis digunakan untuk menghitung profil seropositif individu menggunakan software TIGR multiarray eksperimen viewer (MeV) [57]. Analisis clustering dilakukan dengan menggunakan average linkage clustering dengan Euclidean distance sebagai metrik kesamaan.


Infeksi Lintas Spesies dan Analisisnya

AbstrakKemampuan patogen tertentu untuk menginfeksi banyak inang telah menyebabkan pengembangan inang nonvertebrata yang dapat dilacak secara genetik untuk menjelaskan mekanisme molekuler interaksi antara patogen ini dan inangnya. Penggunaan tanaman, serangga, nematoda, dan inang protozoa untuk mempelajari patogen manusia telah memfasilitasi penjelasan sifat molekuler patogenesis dan respons inang. Analisis virulensi patogen multihost pada inang masing-masing mengungkapkan bahwa patogen menggunakan banyak strategi ofensif universal untuk mengatasi pertahanan inang, terlepas dari garis keturunan evolusi inang. Demikian juga, diseksi genetik dari respons pertahanan inang nonvertebrata juga telah menunjukkan bahwa fitur utama yang mendasari respons pertahanan inang sangat dipertahankan. Ulasan ini merangkum bagaimana informasi yang diperoleh dari analisis infeksi lintas spesies berkontribusi pada pemahaman kita tentang interaksi inang-patogen.


4. DISKUSI

Dalam penelitian ini, kami telah melakukan analisis evolusioner menggunakan 272 sekuens genomik virus corona yang diperoleh dari berbagai lokasi geografis. Hasil kami menunjukkan bahwa urutan novel coronavirus yang diperoleh dari wabah pneumonia virus yang terjadi di kota Wuhan membentuk kelompok terpisah yang sangat khas untuk SARS-CoV. SARS-CoV pertama kali muncul di China pada tahun 2002 dan kemudian menyebar ke 37 negara/wilayah pada tahun 2003 dan menyebabkan wabah global terkait perjalanan dengan tingkat kematian 9,6%. 26 Lebih penting lagi, hasil dari analisis kami mengungkapkan rekombinasi homolog dapat terjadi antara coronavirus kelelawar dan coronavirus yang tidak diketahui asalnya dalam gen glikoprotein lonjakan virus. Analisis homologi sekuens gen glikoprotein lonjakan parsial (1-783 bp) dari 2019-nCoV dilakukan melalui BLAST di situs web NCBI. Menariknya, tidak ada urutan serupa yang ditemukan dengan urutan yang diketahui dalam database, menunjukkan bahwa virus induk rekombinasi yang diduga masih belum diketahui. Studi sebelumnya menunjukkan bahwa rekombinasi SARS dalam gen glikoprotein lonjakan mungkin telah memediasi peristiwa transmisi lintas spesies awal dari kelelawar ke mamalia lain. 27 Analisis plot bootscanning (data tidak ditampilkan) menunjukkan bahwa induk utama 2019-nCoV berasal dari Clade A (bat-SL-CoVZC45 dan bat-SL-CoVZXC21) tetapi membentuk kluster monofiletik yang berbeda dari mereka. Secara keseluruhan, asal usul leluhur 2019-nCoV lebih mungkin dari spesies inang yang berbeda daripada SARS-CoV.

Kisaran inang dari beberapa virus corona hewan tidak menentu. 7 Mereka menarik perhatian kami hanya ketika mereka menyebabkan penyakit manusia seperti SARS, MERS, dan 2019-nCoV pneumonia. 4, 9, 28 Sangat penting untuk menentukan reservoir hewan dari 2019-nCoV untuk memahami mekanisme molekuler dari penyebaran lintas spesiesnya. Rekombinasi homolog dalam protein struktural virus antara coronavirus dari inang yang berbeda mungkin bertanggung jawab untuk transmisi "lintas spesies". 27 Informasi yang diperoleh dari analisis RSCU memberikan beberapa wawasan untuk pertanyaan tentang reservoir hewan satwa liar meskipun memerlukan validasi lebih lanjut dengan studi eksperimental pada model hewan. Saat ini, 2019-nCoV belum diisolasi dari spesies hewan meskipun diperoleh dari satu pasien. Mengidentifikasi dan mengkarakterisasi reservoir hewan untuk 2019-nCoV akan sangat membantu untuk penyelidikan rekombinasi dan untuk pemahaman yang lebih baik tentang penyebaran dari orang ke orang di antara populasi manusia.

2019-nCoV telah menyebabkan total 217 kasus pneumonia yang dikonfirmasi di China pada 20 Januari 2020 dengan pasien baru juga dilaporkan di Hong Kong, Thailand, Singapura, Korea Selatan, dan Jepang. Tidak seperti SARS-CoV, 2019-nCoV tampaknya awalnya menyebabkan bentuk pneumonia virus ringan dan memiliki kemampuan terbatas untuk penyebaran orang-orang. Ini mungkin karena rekombinasi terjadi dalam glikoprotein pengikat reseptor. Namun, ada kekhawatiran tentang adaptasinya pada manusia yang mungkin memperoleh kemampuan untuk bereplikasi lebih efisien dan menyebar lebih cepat melalui kontak orang-orang yang dekat.

Singkatnya, hasil yang diperoleh dari analisis evolusioner kami menunjukkan bahwa 2019-nCoV memiliki informasi genetik paling mirip dengan coronovirus kelelawar dan memiliki bias penggunaan kodon yang paling mirip dengan ular. Selain itu, rekombinasi homolog dapat terjadi dalam glikoprotein lonjakan pengikat reseptor virus, yang dapat menentukan transmisi lintas spesies. Temuan baru ini memerlukan penyelidikan di masa depan untuk secara eksperimental menentukan apakah rekombinasi homolog dalam lonjakan glikoprotein menentukan tropisme 2019-nCoV dalam transmisi dan replikasi virus. Informasi baru yang diperoleh dari analisis evolusioner kami sangat signifikan untuk pengendalian wabah yang efektif yang disebabkan oleh pneumonia yang diinduksi 2019-nCoV.


Kegigihan memilih mutan kisaran inang MHV.

Gambar 2 . Ekspresi antigen virus persisten dalam sel HepG2. Kultur garis sel HepG2 di delapan ruang LabTek ruang terinfeksi V51B (A), V10B (B), V30B (C), atau MHV-A59 (D) pada MOI 5 selama 1 jam. Kultur diwarnai dengan antiserum poliklonal MHV-A59 pada 18 jam pascainfeksi.

HCEA antiserum memblokir masuknya virus persisten ke dalam garis sel manusia.

AntibodiBlokade V51B dalam sel HepG2 reaktivitas silang antigen hCEA a
Bgp1CGM6NCACGM1CEACGM7
Monoklonal
Kol-1+++
Kol-6??+?
Kol-12+? A ???+?
Kol-4++++
Kol-14+????+?
Kat4c++++
pCEA (poliklonal)+++++++
Gambar 3 . Eksperimen blokade dalam sel HepG2. Kultur sel HepG2 dalam slide LabTek delapan ruang tidak diberi perlakuan (tanpa/tanpa) atau diobati dengan berbagai antibodi poliklonal atau monoklonal terhadap gen hCEA pada pengenceran 1:4 selama 1 jam pada suhu kamar. Antibodi dikeluarkan, dan kultur diinfeksi dengan V51B pada MOI 5 selama 1 jam. Inokulum virus telah dihapus, dan media lengkap yang mengandung pengenceran 1:20 dari antibodi yang sama ditambahkan ke dalam bilik. Sampel virus diambil pada waktu yang ditentukan, dan titer virus ditentukan dengan uji plak dalam sel DBT-9. Gambar 4 . ekspresi glikoprotein hCEA dalam sel HepG2. Sel-sel HepG2 diberi perlakuan awal dengan berbagai antisera selama 30 menit pada suhu kamar. Setelah pencucian ekstensif, antiserum IgG kelinci anti-tikus terkonjugasi FITC ditambahkan selama 30 menit pada suhu kamar. Setelah pencucian tambahan, sel-sel dianalisis dengan teknik FACS. (A) Kol-1 (B) Kol-12 (C) Kol-14 (D) Kol-6 (E) Kat4c.

Virus persisten mengenali glikoprotein hCEA sebagai reseptor.

Gambar 5 . replika pSinRep19 tidak menghambat infeksi MHV. Untuk menentukan apakah replika pSinRep19 noncytopathic memblokir replikasi MHV, kultur sel BHK-MHVR ditransfeksi dengan transkrip pSinRep19/T7pol dan dipilih dengan puromisin (5 g/ml) selama beberapa hari. Kultur sel BHK-MHVR/SinT7pol, BHK-MHVR, dan BHK diinfeksi dengan MHV-A59 pada MOI 5 selama 1 jam. Sampel virus dipanen pada waktu yang ditentukan dan diuji dengan uji plak dalam sel DBT. Gambar 6 . Ekspresi hCEA dan hBgp dalam sel BHK. Sel BHK ditransfeksi dengan transkrip dari replika pSinRep19-hBgp dan pSinRep19-hCEA dan dipilih dengan puromisin (5 g/ml) selama beberapa hari. Dengan menggunakan antibodi monoklonal Kat4c, biakan disortir menjadi garis sel BHK-hBgp1 (A), BHK-hBgp1+ (B), dan BHK-hCEA (C). Garis sel ini ditumbuhkan menjadi stok besar garis sel yang mengekspresikan tingkat hCEA atau hBgp yang relatif seragam. Analisis FACS dilakukan dengan antibodi monoklonal Kat4c seperti yang dijelaskan sebelumnya (12). Gambar 7 . Replikasi MHV dalam sel BHK mengekspresikan glikoprotein hCEA. Kultur sel BHK, BHK-hCEA, BHK-hBgp1, dan BHK-hBgp1+ terinfeksi dengan V51B atau MHV-A59, seperti yang ditunjukkan, pada MOI 5 selama 1 jam pada suhu kamar. Dalam beberapa percobaan, sel-sel telah diberi perlakuan awal dengan pengenceran 1:4 pCEA atau EDDA antibodi nonspesifik selama 30 menit sebelum infeksi. Setelah infeksi, kultur dicuci secara ekstensif dan sampel virus diambil pada waktu yang ditentukan. Gambar 8. Antigen virus dalam sel BHK mengekspresikan glikoprotein hCEA. Kultur diperlakukan seperti yang dijelaskan untuk Gambar. 7 difiksasi dan diwarnai FA untuk keberadaan antigen virus. (A) Sel BHK-hCEA yang terinfeksi V51B (B) Sel BHK yang terinfeksi V51B (C) Sel BHK-hCEA yang terinfeksi MHV-A59 (D) Sel BHK yang terinfeksi MHV-A59. Gambar 9 . Replikasi virus persisten dalam sel BHK-hCEA. Kultur sel BHK-hCEA (10 6) diinfeksi dengan MHV-A59, V10B, V30B, V51A, dan V51B pada MOI 5 selama 1 jam pada suhu kamar. Titer virus dipanen pada waktu yang ditentukan untuk analisis dengan uji plak.

Mengapa Para Ilmuwan Tweak Virus Lab untuk Membuatnya Lebih Menular

Kotak peralatan mikrobiologi mencakup teknik untuk menginduksi mutasi pada virus yang memberi kekuatan baru bagi mikroba. Para ilmuwan melakukan manipulasi ini karena berbagai alasan, termasuk ingin memahami bagaimana mikroba menghindari deteksi oleh sistem kekebalan kita. Tetapi menambahkan kemampuan pada patogen membawa risiko yang jelas, terutama jika &ldquogain fungsi&rdquo ini melibatkan peningkatan virulensi atau daya menular. Melarikan diri dari laboratorium, secara tidak sengaja atau dirancang, adalah suatu kemungkinan. Jadi mengapa melakukannya? Beberapa peneliti berpendapat bahwa penelitian tersebut dapat memberikan gambaran tentang apa yang dapat dilakukan virus sebelum masuk ke alam dan menjadi ancaman bagi manusia.

Kontroversi atas penelitian keuntungan-fungsi telah menghasilkan makalah akademis, konferensi, dan bahkan moratorium pada tahun 2014, ketika pemerintah AS menghentikan pendanaan selama tiga tahun hingga langkah-langkah dapat diambil untuk memastikan keamanan prosedur. Perdebatan tentang eksperimen gain-of-fungsi berlanjut di fase akhir pandemi saat pemikiran beralih ke &ldquonext one&rdquo atau kemungkinan tindakan kedua untuk COVID-19. Science policy makers must wrestle with defining the rare instances in which the benefits of experiments that enhance a virus&rsquos capacity to survive and flourish in human hosts outweigh any risks.

Densely technical discussions often bog down over the very definition of gain of function. Recently, semantics were front and center in the debate over whether National Institutes of Health&ndashfunded work at the Wuhan Institute of Virology (WIV) in China constituted gain-of-function research, a contention denied by the U.S. agency. The WIV has also been the focus of a revived dispute over whether SARS-CoV-2, the virus that causes COVID-19, escaped from its facility.

Here are a few basic answers to questions about why an obscure technical term now receives so much attention.

What is gain of function research?

Techniques to enhance some aspect of an organism&rsquos functioning are commonplace in research and applied to everything from mice to measles. One typical application of this approach is tweaking mouse genes to generate more of a protein that limits fat deposition.

But that is not the kind of gain-of-function study that raises fears among scientists and regulators. The high-risk practices are those that create mutations to examine whether a pathogen becomes more contagious or lethal as a means of estimating future threats.

Some experts acknowledge the critical differences between the two types of studies. One proposed term to represent the more threatening subset of this research is &ldquopotential pandemic pathogens,&rdquo says Marc Lipsitch, a professor of epidemiology at the Harvard T. H. Chan School of Public Health. That phrase &ldquosingles out the name and reason for being concerned,&rdquo he adds. It has not caught on in common usage, however, returning only about 8,500 results in a Google search, compared with 13.4 million for &ldquogain of function.&rdquo

Making this distinction is important for a few reasons, Lipsitch says. When the U.S. government placed the 2014 moratorium on &ldquogain of function research,&rdquo some of the studies that were affected carried no obvious risk of setting off a pandemic.

What is the purpose of this research?

Knowing what makes a microbe more dangerous enables preparation of countermeasures, says Lipsitch, who is one of 18 signatories to a May 14 letter, published in Sains, that calls for the investigation of a SARS-CoV-2 lab spillover as one of several possible explanations for the origins of the COVID-19 pandemic. He points to the difficulties of studying viruses for the development of vaccines and treatments without doing experiments in a mouse or in other nonhuman animals. There is, Lipsitch says, a &ldquodirect path from doing that research to gaining public health benefits,&rdquo enabling a balancing of risks and potential benefits.

The riskier version of gain-of-function research creates viruses with abilities they do not have in nature. In two separate studies in 2011, scientists famously and controversially did just that with the H5N1 influenza virus, or &ldquobird flu,&rdquo resulting in a version capable of airborne transmission among ferrets. The naturally occurring virus does not have this ability. Making mammal-to-mammal transmission easier set off alarm bells and triggered discussion of a U.S. moratorium.

In 2015 researchers engineered a hybrid pathogen that combined features of the original SARS virus (SARS-CoV) that infected humans in the early 2000s with that of a bat coronavirus. Most bat coronaviruses cannot infect the cells lining the human respiratory tract. This experiment was intended to mimic what would happen if a third species served as a mixing vat for the bat and human viruses to exchange genetic material. The result was a pathogen that could enter human cells and also cause disease in mice. Reactions to this work were polarized, as demonstrated by experts quoted in a 2015 article in Alam: one said that all the research did was create a &ldquonew, non-natural risk&rdquo among the multitude that already exist, while another contended that it showed the potential for this bat virus to become a &ldquoclear and present danger.&rdquo

Experts in the latter camp argue that gain-of-function virus studies can presage what will eventually happen in nature. Speeding things up in the lab gives researchers firsthand evidence about how a virus might evolve. Such insights could drive predictions about future viral behaviors in order to stay a step ahead of these pathogens.

That calculation must be made on a case-by-case basis, Lipsitch says. &ldquoThere is not one-answer-fits-all,&rdquo he adds. But the key question to address in this complex computation is &ldquoIs this work so valuable for public health that it outshines the risk to public health in doing it?&rdquo

Lipsitch was &ldquovery outspoken,&rdquo as he puts it, about the influenza-ferret study, and he led the effort for the 2014 moratorium on similar gain-of-function work. &ldquoI did that because I thought that we need to have a real accounting of the benefits and risks,&rdquo he says. &ldquoI had a view that the benefits were very small, and I still have that view.&rdquo

The moratorium was lifted in 2017. A U.S. government review panel later approved a resumption of funding for more lab studies involving gain-of-function modifications of bird flu viruses in ferrets. Conditions of the approvals, according to reports, included enhanced safety measures and reporting requirements.

As for SARS-CoV-2, the virus of most urgent interest right now, the NIH released a statement on May 19 that neither the agency nor its National Institute of Allergy and Infectious Diseases has &ldquoever approved any grant that would have supported &lsquogain-of-function&rsquo research on coronaviruses that would have increased their transmissibility or lethality for humans.&rdquo

What are the risks?

Predictions based on gain-of-function studies may be hypothetical, but lab breaches in the U.S. are not. Serious violations are uncommon and have almost never resulted in a pathogen being released into the community. But 2014 showed why human error may prove to be the biggest wild card in planning these experiments.

Several lab accidents that year endangered researchers and set off waves of uneasiness. These incidents were not gain-of-function mishaps, but they demonstrated the potential threats posed by a biosafety lab&mdashwhether from negligence or malfeasance. In 2014 about 75 Atlanta-based employees at the U.S. Centers for Disease Control and Prevention learned about their potential exposure to anthrax after safety practices were ignored. Also, several long-forgotten vials of freeze-dried smallpox&mdasha pathogen long thought to be stored in only two places, one in Russia and one in the U.S.&mdashturned up during a cold-storage cleanup at the NIH that year. And the CDC made news again a month later, after it sent out vials of a relatively benign influenza virus contaminated with the much more deadly H5N1 avian flu virus. The possible reason, as reported in Sains, was that a researcher was &ldquooverworked and rushing to make a lab meeting.&rdquo

Michael Imperiale, a professor of microbiology and immunology and associate vice president for research and compliance at the University of Michigan, co-authored a 2020 editorial about gain-of-function studies that said that the key to planning them is to have proper mechanisms to ward off the threats of accidental or intentional harm. &ldquoIf proper biosafety procedures are in place and proper containment is used, the risks can be mitigated substantially,&rdquo he says. Biosafety level 4 (BSL-4) labs have the highest containment precautions in place, and the U.S. currently has 13 or more such facilities planned or in operation. Research on the novel coronavirus is handled in labs one notch down: BSL-3.

In their editorial, Imperiale and his co-author Arturo Casadevall, editor in chief of mBIO, wrote that even predicting the threat level of an accidental release is difficult. After publication of the studies of ferret-to-ferret transmission of engineered H5N1, two groups tried to predict what would have happened if this virus had escaped into the human population. One team, Imperiale and Casadevall wrote, predicted an &ldquoextremely high level&rdquo of transmission. The other, from one of the labs involved in the ferret-influenza work, concluded otherwise.

In the context of the COVID-19 pandemic, the authors of the editorial wrote, the source of a pathogen&mdashwhether from nature or a lab&mdashdoes not change how the world should prepare to respond to it. But gain-of-function experiments should be governed by transparency in planning the research, a &ldquorededication&rdquo to biosafety and a strong surveillance program to capture breaches.

What alternative techniques are available to test a potential viral threat?

If a virus has already moved from an animal host to humans, gain-of-function research may be unnecessary, Imperiale says. &ldquoIn these cases, there may be animal models that serve as useful surrogates for humans&rdquo in testing the virus&rsquos effects, he says.

Researchers can also test the capacity of virus proteins to engage with different kinds of cells. Software can predict how these proteins might interact with various cell types or how their genetic sequences could be associated with specific virus features. Also, if the researchers use cells in a lab dish, the viruses might be designed not to replicate.

Another option is loss-of-function research. Using versions of a virus with less pathogenic potential is another way to unlock that microbe&rsquos secrets. Still, highly pathogenic forms can be quite different from their less threatening counterparts&mdashfor example, they may differ in how often they replicate&mdashpossibly limiting the usefulness of such studies.


2 thoughts on &ldquoCross-Species Transmission in Rabies&rdquo

This was a really cool and informative post which clarified a lot of questions I had about CST. The fact that “the majority of viruses from cross-species infections were tightly nested among genetically similar bat species” paired with the statistics given makes me wonder how close human and bat defense systems really are.

Interesting study, though it might be overstepping its bounds in generalization. While this may have worked with bats infecting bats, I doubt that transmission between more dissimilar species, such as bats, pigs, or birds to humans, will factor host similarity to such a degree. For this reason, viral mutation still seems like the most plausible reason for cross-species transmission, though this finding may be much more applicable when applied to CST between more similar species, such as in this case.


Tonton videonya: Բուժ ԻնֆոBuj Info 216-Բուժ լրահոս-Սոցիալապես անապահովների հիվանդանոցային բուժօգնություն (Juni 2022).


Komentar:

  1. Ail

    New items are always cool !!!

  2. Linleah

    Ini adalah bagian yang berharga

  3. Male

    Yes, the real truth

  4. Brasar

    Ini salah saya.

  5. Weyland

    Sepertinya saya bahwa ide dalam artikel ini tidak sepenuhnya diungkapkan. Penulis, dapatkah Anda menambahkan sesuatu untuk ini?

  6. Jody

    SpasibO akan kami gunakan)



Menulis pesan